Incidental Mutation 'R6250:Ccnd3'
ID505939
Institutional Source Beutler Lab
Gene Symbol Ccnd3
Ensembl Gene ENSMUSG00000034165
Gene Namecyclin D3
Synonyms9230106B05Rik
MMRRC Submission 044367-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6250 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location47505051-47599691 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 47597562 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 186 (L186*)
Ref Sequence ENSEMBL: ENSMUSP00000138640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024783] [ENSMUST00000037333] [ENSMUST00000171031] [ENSMUST00000182129] [ENSMUST00000182209] [ENSMUST00000182506] [ENSMUST00000182539] [ENSMUST00000182848] [ENSMUST00000182874] [ENSMUST00000182935] [ENSMUST00000183044] [ENSMUST00000183158] [ENSMUST00000183177] [ENSMUST00000183206] [ENSMUST00000183210] [ENSMUST00000183256]
Predicted Effect probably benign
Transcript: ENSMUST00000024783
SMART Domains Protein: ENSMUSP00000024783
Gene: ENSMUSG00000023988

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
low complexity region 52 69 N/A INTRINSIC
Pfam:Bystin 140 430 1.1e-144 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000037333
AA Change: L186*
SMART Domains Protein: ENSMUSP00000040488
Gene: ENSMUSG00000034165
AA Change: L186*

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171031
AA Change: L186*
SMART Domains Protein: ENSMUSP00000126141
Gene: ENSMUSG00000034165
AA Change: L186*

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000182129
AA Change: L186*
SMART Domains Protein: ENSMUSP00000138486
Gene: ENSMUSG00000034165
AA Change: L186*

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Pfam:Cyclin_C 155 214 2.6e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000182209
AA Change: L186*
SMART Domains Protein: ENSMUSP00000138091
Gene: ENSMUSG00000034165
AA Change: L186*

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182281
Predicted Effect probably null
Transcript: ENSMUST00000182506
AA Change: L186*
SMART Domains Protein: ENSMUSP00000138180
Gene: ENSMUSG00000034165
AA Change: L186*

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 251 2.02e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182539
SMART Domains Protein: ENSMUSP00000138458
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
Pfam:Cyclin_C 1 84 1.4e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000182846
AA Change: L112*
Predicted Effect probably null
Transcript: ENSMUST00000182848
AA Change: L186*
SMART Domains Protein: ENSMUSP00000138715
Gene: ENSMUSG00000034165
AA Change: L186*

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Pfam:Cyclin_C 155 243 8.1e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000182874
AA Change: L114*
SMART Domains Protein: ENSMUSP00000138711
Gene: ENSMUSG00000034165
AA Change: L114*

DomainStartEndE-ValueType
PDB:3G33|D 1 69 3e-42 PDB
SCOP:d1g3nc1 22 67 9e-10 SMART
Blast:CYCLIN 26 66 9e-10 BLAST
PDB:2W9F|A 73 119 3e-9 PDB
Blast:CYCLIN 87 119 4e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000182935
Predicted Effect probably null
Transcript: ENSMUST00000183044
AA Change: L186*
SMART Domains Protein: ENSMUSP00000138220
Gene: ENSMUSG00000034165
AA Change: L186*

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183158
SMART Domains Protein: ENSMUSP00000138169
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 1 82 1.71e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000183177
AA Change: L186*
SMART Domains Protein: ENSMUSP00000138640
Gene: ENSMUSG00000034165
AA Change: L186*

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183206
Predicted Effect probably benign
Transcript: ENSMUST00000183210
Predicted Effect probably benign
Transcript: ENSMUST00000183256
SMART Domains Protein: ENSMUSP00000138528
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
Pfam:Cyclin_C 1 70 9.4e-12 PFAM
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK4 or CDK6, whose activtiy is required for cell cycle G1/S transition. This protein has been shown to interact with and be involved in the phosphorylation of tumor suppressor protein Rb. The CDK4 activity associated with this cyclin was reported to be necessary for cell cycle progression through G2 phase into mitosis after UV radiation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe thymus hypoplasia, abnormal thymocyte development, and impaired expansion of immature T lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,150,714 G1195D probably damaging Het
Abhd12 T C 2: 150,839,747 Y241C probably damaging Het
Ak9 T C 10: 41,389,034 V929A possibly damaging Het
Ap3s1 T C 18: 46,754,447 F49S probably damaging Het
Atp9b T C 18: 80,756,521 H801R probably benign Het
B430218F22Rik A G 13: 118,387,408 probably benign Het
BC030867 A G 11: 102,255,062 T55A probably benign Het
Cnbd1 T A 4: 19,098,255 Q55L probably benign Het
Commd10 A G 18: 46,963,688 E54G probably damaging Het
D6Ertd527e G A 6: 87,111,212 G119D unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Disp2 A T 2: 118,790,766 I660F probably damaging Het
Eef1a2 A G 2: 181,151,060 F211L possibly damaging Het
Epb41 A T 4: 131,989,873 F323L probably damaging Het
Eps8l3 A T 3: 107,890,465 I403F probably benign Het
Ercc5 T A 1: 44,164,049 V282D probably damaging Het
Faim A T 9: 98,992,123 M1L probably benign Het
Fbxo24 A G 5: 137,621,281 F111L probably damaging Het
Glrx A T 13: 75,840,110 I48F probably damaging Het
Gucy2g A T 19: 55,217,424 L668Q probably damaging Het
Hectd4 A G 5: 121,339,498 D2828G possibly damaging Het
Hivep2 T C 10: 14,131,759 V1367A probably benign Het
Ipo13 A G 4: 117,912,154 V147A possibly damaging Het
Jchain T C 5: 88,526,175 T37A probably benign Het
Kif1b A G 4: 149,213,643 V1034A probably benign Het
Krt25 T A 11: 99,321,163 N216I probably damaging Het
Lman1l A G 9: 57,615,624 V151A probably benign Het
Mfsd4b1 T C 10: 40,003,110 S264G possibly damaging Het
Mxra8 G T 4: 155,841,089 R82L possibly damaging Het
Nlrp1b A T 11: 71,181,799 I406N probably benign Het
Olfr1381 A T 11: 49,551,884 I46F probably damaging Het
Olfr155 T C 4: 43,854,363 L18P possibly damaging Het
Olfr191 G A 16: 59,085,832 S217F probably damaging Het
Pak7 T C 2: 136,174,269 probably benign Het
Pcsk4 T C 10: 80,325,592 R222G probably benign Het
Pik3cb A C 9: 99,094,598 F149V probably benign Het
Plscr4 G A 9: 92,484,828 R165Q possibly damaging Het
Ppp2r2a A T 14: 67,038,954 V34E probably damaging Het
Prpf8 T G 11: 75,493,508 S659R possibly damaging Het
Ptprd A G 4: 76,128,995 S342P probably damaging Het
Pum2 T C 12: 8,744,755 probably null Het
Ranbp3 T G 17: 56,677,208 probably null Het
Rassf7 A G 7: 141,217,243 E123G probably damaging Het
Rcor1 G T 12: 111,111,877 A469S probably benign Het
Rcor3 G T 1: 192,100,896 P524Q probably damaging Het
Rnf44 A T 13: 54,682,107 probably null Het
Rtf1 T C 2: 119,675,177 V37A unknown Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Setbp1 T C 18: 78,858,002 T817A probably benign Het
Setd1a A G 7: 127,791,299 E506G unknown Het
Slc30a8 G A 15: 52,335,149 R330Q probably benign Het
Snx22 C A 9: 66,069,641 E14* probably null Het
Spata31d1a A G 13: 59,701,801 S838P possibly damaging Het
Sprr4 G T 3: 92,500,463 Q11K unknown Het
Trpm3 A G 19: 22,910,054 N839S probably benign Het
Vps9d1 T C 8: 123,248,208 probably null Het
Vwa3b T C 1: 37,051,885 probably null Het
Ythdf1 T C 2: 180,911,100 T414A probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Ccnd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Ccnd3 APN 17 47594845 missense probably benign
R1494:Ccnd3 UTSW 17 47598108 unclassified probably null
R4812:Ccnd3 UTSW 17 47597580 critical splice donor site probably null
R5589:Ccnd3 UTSW 17 47598619 missense probably damaging 1.00
R6381:Ccnd3 UTSW 17 47505224 utr 5 prime probably benign
R6854:Ccnd3 UTSW 17 47578720 utr 5 prime probably benign
R7695:Ccnd3 UTSW 17 47597496 missense probably damaging 1.00
X0050:Ccnd3 UTSW 17 47593680 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GACCCTTCTGTCAAATTCTCGG -3'
(R):5'- TCCATCTACCCAAGGTGTACC -3'

Sequencing Primer
(F):5'- AAATTCTCGGCCCCCTCGG -3'
(R):5'- TGGCACCAGGAACAACAAAATATC -3'
Posted On2018-02-28