Incidental Mutation 'R6250:Ranbp3'
ID505940
Institutional Source Beutler Lab
Gene Symbol Ranbp3
Ensembl Gene ENSMUSG00000002372
Gene NameRAN binding protein 3
Synonyms2610024N24Rik
MMRRC Submission 044367-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R6250 (G1)
Quality Score80.0075
Status Validated
Chromosome17
Chromosomal Location56673225-56711769 bp(+) (GRCm38)
Type of Mutationintron (3797 bp from exon)
DNA Base Change (assembly) T to G at 56677208 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000002445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002445]
Predicted Effect probably null
Transcript: ENSMUST00000002445
SMART Domains Protein: ENSMUSP00000002445
Gene: ENSMUSG00000002372

DomainStartEndE-ValueType
low complexity region 275 287 N/A INTRINSIC
RanBD 305 432 1.7e-12 SMART
low complexity region 439 454 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a RanBD1 domain that is found in both the nucleus and cytoplasm. This protein plays a role in nuclear export as part of a heteromeric complex. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,150,714 G1195D probably damaging Het
Abhd12 T C 2: 150,839,747 Y241C probably damaging Het
Ak9 T C 10: 41,389,034 V929A possibly damaging Het
Ap3s1 T C 18: 46,754,447 F49S probably damaging Het
Atp9b T C 18: 80,756,521 H801R probably benign Het
B430218F22Rik A G 13: 118,387,408 probably benign Het
BC030867 A G 11: 102,255,062 T55A probably benign Het
Ccnd3 T A 17: 47,597,562 L186* probably null Het
Cnbd1 T A 4: 19,098,255 Q55L probably benign Het
Commd10 A G 18: 46,963,688 E54G probably damaging Het
D6Ertd527e G A 6: 87,111,212 G119D unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Disp2 A T 2: 118,790,766 I660F probably damaging Het
Eef1a2 A G 2: 181,151,060 F211L possibly damaging Het
Epb41 A T 4: 131,989,873 F323L probably damaging Het
Eps8l3 A T 3: 107,890,465 I403F probably benign Het
Ercc5 T A 1: 44,164,049 V282D probably damaging Het
Faim A T 9: 98,992,123 M1L probably benign Het
Fbxo24 A G 5: 137,621,281 F111L probably damaging Het
Glrx A T 13: 75,840,110 I48F probably damaging Het
Gucy2g A T 19: 55,217,424 L668Q probably damaging Het
Hectd4 A G 5: 121,339,498 D2828G possibly damaging Het
Hivep2 T C 10: 14,131,759 V1367A probably benign Het
Ipo13 A G 4: 117,912,154 V147A possibly damaging Het
Jchain T C 5: 88,526,175 T37A probably benign Het
Kif1b A G 4: 149,213,643 V1034A probably benign Het
Krt25 T A 11: 99,321,163 N216I probably damaging Het
Lman1l A G 9: 57,615,624 V151A probably benign Het
Mfsd4b1 T C 10: 40,003,110 S264G possibly damaging Het
Mxra8 G T 4: 155,841,089 R82L possibly damaging Het
Nlrp1b A T 11: 71,181,799 I406N probably benign Het
Olfr1381 A T 11: 49,551,884 I46F probably damaging Het
Olfr155 T C 4: 43,854,363 L18P possibly damaging Het
Olfr191 G A 16: 59,085,832 S217F probably damaging Het
Pak7 T C 2: 136,174,269 probably benign Het
Pcsk4 T C 10: 80,325,592 R222G probably benign Het
Pik3cb A C 9: 99,094,598 F149V probably benign Het
Plscr4 G A 9: 92,484,828 R165Q possibly damaging Het
Ppp2r2a A T 14: 67,038,954 V34E probably damaging Het
Prpf8 T G 11: 75,493,508 S659R possibly damaging Het
Ptprd A G 4: 76,128,995 S342P probably damaging Het
Pum2 T C 12: 8,744,755 probably null Het
Rassf7 A G 7: 141,217,243 E123G probably damaging Het
Rcor1 G T 12: 111,111,877 A469S probably benign Het
Rcor3 G T 1: 192,100,896 P524Q probably damaging Het
Rnf44 A T 13: 54,682,107 probably null Het
Rtf1 T C 2: 119,675,177 V37A unknown Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Setbp1 T C 18: 78,858,002 T817A probably benign Het
Setd1a A G 7: 127,791,299 E506G unknown Het
Slc30a8 G A 15: 52,335,149 R330Q probably benign Het
Snx22 C A 9: 66,069,641 E14* probably null Het
Spata31d1a A G 13: 59,701,801 S838P possibly damaging Het
Sprr4 G T 3: 92,500,463 Q11K unknown Het
Trpm3 A G 19: 22,910,054 N839S probably benign Het
Vps9d1 T C 8: 123,248,208 probably null Het
Vwa3b T C 1: 37,051,885 probably null Het
Ythdf1 T C 2: 180,911,100 T414A probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Ranbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Ranbp3 APN 17 56709238 missense probably damaging 1.00
IGL02801:Ranbp3 APN 17 56710766 missense probably benign
IGL03004:Ranbp3 APN 17 56707207 missense probably damaging 1.00
Waif UTSW 17 56677208 intron probably null
R0094:Ranbp3 UTSW 17 56709338 unclassified probably benign
R0139:Ranbp3 UTSW 17 56709272 missense possibly damaging 0.95
R0419:Ranbp3 UTSW 17 56708219 missense possibly damaging 0.92
R0426:Ranbp3 UTSW 17 56707169 missense probably benign
R0629:Ranbp3 UTSW 17 56708200 missense possibly damaging 0.95
R0632:Ranbp3 UTSW 17 56702896 splice site probably benign
R1495:Ranbp3 UTSW 17 56705527 missense probably benign 0.03
R1525:Ranbp3 UTSW 17 56710865 missense possibly damaging 0.52
R2044:Ranbp3 UTSW 17 56673367 start gained probably benign
R2093:Ranbp3 UTSW 17 56710145 missense probably damaging 1.00
R4649:Ranbp3 UTSW 17 56696640 critical splice donor site probably null
R4780:Ranbp3 UTSW 17 56673346 start gained probably benign
R5568:Ranbp3 UTSW 17 56701543 critical splice donor site probably null
R5642:Ranbp3 UTSW 17 56710703 missense probably benign 0.01
R5806:Ranbp3 UTSW 17 56710717 missense probably benign 0.01
R5875:Ranbp3 UTSW 17 56707955 critical splice donor site probably null
R6142:Ranbp3 UTSW 17 56686018 missense probably benign 0.33
R6745:Ranbp3 UTSW 17 56709308 missense probably benign 0.24
R7222:Ranbp3 UTSW 17 56710211 missense probably damaging 1.00
R7571:Ranbp3 UTSW 17 56707923 missense probably benign 0.01
R7718:Ranbp3 UTSW 17 56696718 missense probably damaging 0.99
R7744:Ranbp3 UTSW 17 56708219 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCATCTCAGGCATTCTCAGG -3'
(R):5'- AGATCTTGGTTCCAGGCTGTC -3'

Sequencing Primer
(F):5'- ACTGGGCATTCAGAGTCATC -3'
(R):5'- AGGCTGTCTCTCTCCCAGGAG -3'
Posted On2018-02-28