Incidental Mutation 'R6250:Atp9b'
ID505944
Institutional Source Beutler Lab
Gene Symbol Atp9b
Ensembl Gene ENSMUSG00000024566
Gene NameATPase, class II, type 9B
SynonymsIIb
MMRRC Submission 044367-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6250 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location80734141-80934058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80756521 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 801 (H801R)
Ref Sequence ENSEMBL: ENSMUSP00000153157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091790] [ENSMUST00000225235] [ENSMUST00000225980]
Predicted Effect probably benign
Transcript: ENSMUST00000091790
AA Change: H801R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000089394
Gene: ENSMUSG00000024566
AA Change: H801R

DomainStartEndE-ValueType
low complexity region 11 39 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 110 181 5.3e-21 PFAM
Pfam:E1-E2_ATPase 186 444 9.1e-15 PFAM
Pfam:Hydrolase 463 885 2.7e-13 PFAM
Pfam:HAD 464 882 4.8e-14 PFAM
Pfam:Cation_ATPase 563 664 3.7e-7 PFAM
Pfam:PhoLip_ATPase_C 899 1128 1.1e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224283
Predicted Effect probably benign
Transcript: ENSMUST00000225092
Predicted Effect probably benign
Transcript: ENSMUST00000225218
Predicted Effect probably benign
Transcript: ENSMUST00000225235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225692
Predicted Effect probably benign
Transcript: ENSMUST00000225980
AA Change: H801R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,150,714 G1195D probably damaging Het
Abhd12 T C 2: 150,839,747 Y241C probably damaging Het
Ak9 T C 10: 41,389,034 V929A possibly damaging Het
Ap3s1 T C 18: 46,754,447 F49S probably damaging Het
B430218F22Rik A G 13: 118,387,408 probably benign Het
BC030867 A G 11: 102,255,062 T55A probably benign Het
Ccnd3 T A 17: 47,597,562 L186* probably null Het
Cnbd1 T A 4: 19,098,255 Q55L probably benign Het
Commd10 A G 18: 46,963,688 E54G probably damaging Het
D6Ertd527e G A 6: 87,111,212 G119D unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Disp2 A T 2: 118,790,766 I660F probably damaging Het
Eef1a2 A G 2: 181,151,060 F211L possibly damaging Het
Epb41 A T 4: 131,989,873 F323L probably damaging Het
Eps8l3 A T 3: 107,890,465 I403F probably benign Het
Ercc5 T A 1: 44,164,049 V282D probably damaging Het
Faim A T 9: 98,992,123 M1L probably benign Het
Fbxo24 A G 5: 137,621,281 F111L probably damaging Het
Glrx A T 13: 75,840,110 I48F probably damaging Het
Gucy2g A T 19: 55,217,424 L668Q probably damaging Het
Hectd4 A G 5: 121,339,498 D2828G possibly damaging Het
Hivep2 T C 10: 14,131,759 V1367A probably benign Het
Ipo13 A G 4: 117,912,154 V147A possibly damaging Het
Jchain T C 5: 88,526,175 T37A probably benign Het
Kif1b A G 4: 149,213,643 V1034A probably benign Het
Krt25 T A 11: 99,321,163 N216I probably damaging Het
Lman1l A G 9: 57,615,624 V151A probably benign Het
Mfsd4b1 T C 10: 40,003,110 S264G possibly damaging Het
Mxra8 G T 4: 155,841,089 R82L possibly damaging Het
Nlrp1b A T 11: 71,181,799 I406N probably benign Het
Olfr1381 A T 11: 49,551,884 I46F probably damaging Het
Olfr155 T C 4: 43,854,363 L18P possibly damaging Het
Olfr191 G A 16: 59,085,832 S217F probably damaging Het
Pak7 T C 2: 136,174,269 probably benign Het
Pcsk4 T C 10: 80,325,592 R222G probably benign Het
Pik3cb A C 9: 99,094,598 F149V probably benign Het
Plscr4 G A 9: 92,484,828 R165Q possibly damaging Het
Ppp2r2a A T 14: 67,038,954 V34E probably damaging Het
Prpf8 T G 11: 75,493,508 S659R possibly damaging Het
Ptprd A G 4: 76,128,995 S342P probably damaging Het
Pum2 T C 12: 8,744,755 probably null Het
Ranbp3 T G 17: 56,677,208 probably null Het
Rassf7 A G 7: 141,217,243 E123G probably damaging Het
Rcor1 G T 12: 111,111,877 A469S probably benign Het
Rcor3 G T 1: 192,100,896 P524Q probably damaging Het
Rnf44 A T 13: 54,682,107 probably null Het
Rtf1 T C 2: 119,675,177 V37A unknown Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Setbp1 T C 18: 78,858,002 T817A probably benign Het
Setd1a A G 7: 127,791,299 E506G unknown Het
Slc30a8 G A 15: 52,335,149 R330Q probably benign Het
Snx22 C A 9: 66,069,641 E14* probably null Het
Spata31d1a A G 13: 59,701,801 S838P possibly damaging Het
Sprr4 G T 3: 92,500,463 Q11K unknown Het
Trpm3 A G 19: 22,910,054 N839S probably benign Het
Vps9d1 T C 8: 123,248,208 probably null Het
Vwa3b T C 1: 37,051,885 probably null Het
Ythdf1 T C 2: 180,911,100 T414A probably damaging Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Atp9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Atp9b APN 18 80917888 intron probably benign
IGL00769:Atp9b APN 18 80912853 missense probably benign 0.08
IGL00851:Atp9b APN 18 80765910 missense probably damaging 1.00
IGL01529:Atp9b APN 18 80844611 intron probably benign
IGL01637:Atp9b APN 18 80756455 missense probably benign 0.06
IGL01973:Atp9b APN 18 80758303 missense probably benign 0.02
IGL02082:Atp9b APN 18 80891930 intron probably benign
IGL02560:Atp9b APN 18 80762198 missense probably benign 0.23
IGL02981:Atp9b APN 18 80754289 missense possibly damaging 0.93
IGL03151:Atp9b APN 18 80776850 missense probably benign 0.28
IGL03304:Atp9b APN 18 80917877 missense probably damaging 1.00
IGL03348:Atp9b APN 18 80836422 missense possibly damaging 0.88
R0056:Atp9b UTSW 18 80765803 missense probably damaging 0.99
R0355:Atp9b UTSW 18 80909585 intron probably benign
R0366:Atp9b UTSW 18 80762102 missense probably damaging 1.00
R0557:Atp9b UTSW 18 80765922 missense probably damaging 1.00
R0612:Atp9b UTSW 18 80753956 missense possibly damaging 0.81
R1099:Atp9b UTSW 18 80858626 missense probably damaging 1.00
R1126:Atp9b UTSW 18 80778954 missense probably damaging 1.00
R1499:Atp9b UTSW 18 80762138 missense probably damaging 0.99
R1499:Atp9b UTSW 18 80778907 missense probably benign 0.02
R1764:Atp9b UTSW 18 80909591 critical splice donor site probably null
R1780:Atp9b UTSW 18 80776897 nonsense probably null
R1782:Atp9b UTSW 18 80765922 missense probably damaging 1.00
R1835:Atp9b UTSW 18 80778883 missense probably benign 0.00
R1859:Atp9b UTSW 18 80749920 missense possibly damaging 0.95
R1953:Atp9b UTSW 18 80754307 missense possibly damaging 0.80
R2140:Atp9b UTSW 18 80736087 missense probably damaging 0.99
R2191:Atp9b UTSW 18 80753051 missense probably damaging 1.00
R4118:Atp9b UTSW 18 80749829 missense possibly damaging 0.83
R4605:Atp9b UTSW 18 80753149 critical splice acceptor site probably null
R4654:Atp9b UTSW 18 80891878 missense probably benign 0.00
R4767:Atp9b UTSW 18 80753070 missense probably damaging 1.00
R4775:Atp9b UTSW 18 80765769 critical splice donor site probably null
R4936:Atp9b UTSW 18 80736093 missense possibly damaging 0.58
R5096:Atp9b UTSW 18 80762184 missense probably benign 0.39
R5279:Atp9b UTSW 18 80912858 missense probably damaging 0.98
R5394:Atp9b UTSW 18 80776837 missense probably benign 0.16
R5774:Atp9b UTSW 18 80933932 missense probably damaging 0.96
R5877:Atp9b UTSW 18 80752789 missense probably benign
R6080:Atp9b UTSW 18 80738808 missense probably benign 0.03
R6170:Atp9b UTSW 18 80877347 missense probably benign 0.16
R6340:Atp9b UTSW 18 80778900 missense probably benign 0.38
R6498:Atp9b UTSW 18 80777015 missense probably benign 0.03
R6620:Atp9b UTSW 18 80808687 nonsense probably null
R6632:Atp9b UTSW 18 80808649 missense probably damaging 1.00
R6665:Atp9b UTSW 18 80917735 missense probably benign 0.26
R6821:Atp9b UTSW 18 80847248 missense probably damaging 1.00
R6927:Atp9b UTSW 18 80891857 missense possibly damaging 0.63
R6977:Atp9b UTSW 18 80753102 missense probably damaging 1.00
R7133:Atp9b UTSW 18 80909656 missense
R7188:Atp9b UTSW 18 80917826 missense
R7396:Atp9b UTSW 18 80736842 missense
R7432:Atp9b UTSW 18 80765841 missense
R7457:Atp9b UTSW 18 80917618 intron probably null
R7877:Atp9b UTSW 18 80847197 missense
R7960:Atp9b UTSW 18 80847197 missense
R8072:Atp9b UTSW 18 80765061 missense
R8167:Atp9b UTSW 18 80847183 missense
Z1176:Atp9b UTSW 18 80765865 missense
Predicted Primers PCR Primer
(F):5'- CACACACTTCATCAGAGGTCAG -3'
(R):5'- GTCTGTAAGGACCGTGCTAC -3'

Sequencing Primer
(F):5'- CACTTCATCAGAGGTCAGTCTTAAG -3'
(R):5'- TGAAGGATCCTACTGGGA -3'
Posted On2018-02-28