Incidental Mutation 'R6254:Olfr1024'
ID505952
Institutional Source Beutler Lab
Gene Symbol Olfr1024
Ensembl Gene ENSMUSG00000075206
Gene Nameolfactory receptor 1024
SynonymsGA_x6K02T2Q125-47384320-47383337, MOR197-1
MMRRC Submission 044371-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R6254 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85904069-85905052 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85904505 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 183 (Y183F)
Ref Sequence ENSEMBL: ENSMUSP00000097496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099912]
Predicted Effect probably damaging
Transcript: ENSMUST00000099912
AA Change: Y183F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097496
Gene: ENSMUSG00000075206
AA Change: Y183F

DomainStartEndE-ValueType
Pfam:7tm_4 36 313 7.6e-52 PFAM
Pfam:7tm_1 46 295 4.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215677
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.4%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik A G 8: 13,706,043 D26G possibly damaging Het
Adam6b A T 12: 113,489,570 L2F probably damaging Het
Ank2 T A 3: 126,941,804 probably benign Het
Anpep T G 7: 79,839,233 D369A probably damaging Het
App T C 16: 84,978,177 E599G probably damaging Het
Asphd1 C T 7: 126,948,868 V88I probably benign Het
Atad5 A T 11: 80,127,389 I1389F probably damaging Het
Blm T C 7: 80,480,342 N950S probably benign Het
Bsn A T 9: 108,111,866 M2229K probably damaging Het
Cacna2d2 A G 9: 107,509,216 M181V probably benign Het
Cadps2 T A 6: 23,329,163 probably null Het
Cdh1 T A 8: 106,663,798 V590D probably damaging Het
Cdk5rap2 G A 4: 70,364,032 T160M probably damaging Het
Chrna5 A G 9: 55,006,456 M325V probably benign Het
Clca3a2 A G 3: 144,802,134 I116T probably benign Het
Cyp2c23 T C 19: 44,005,463 K488R probably benign Het
Edil3 T A 13: 89,319,729 I451N probably damaging Het
Exph5 T G 9: 53,372,710 S364A possibly damaging Het
Fam84b A G 15: 60,823,801 I32T probably damaging Het
Fam98c A G 7: 29,154,517 S209P probably damaging Het
Fat3 G A 9: 15,996,145 L2854F probably benign Het
Fbxo38 T C 18: 62,505,500 probably null Het
Fermt2 T C 14: 45,476,059 D205G probably damaging Het
Fmnl1 G A 11: 103,196,315 probably benign Het
Fn3k A G 11: 121,435,068 E27G probably damaging Het
Foxj2 A G 6: 122,838,139 H378R probably damaging Het
Fubp1 A G 3: 152,232,408 K140E possibly damaging Het
Gm4788 A G 1: 139,754,390 I156T probably damaging Het
Gm7694 A T 1: 170,302,534 C98* probably null Het
Golgb1 T C 16: 36,913,978 S1196P probably damaging Het
Gpm6a G A 8: 55,047,396 probably null Het
Hltf T A 3: 20,063,829 N80K possibly damaging Het
Il1rap G A 16: 26,695,270 R251H probably benign Het
Ipo7 T A 7: 110,049,060 D688E probably benign Het
Itgal T A 7: 127,325,203 N897K probably damaging Het
Itsn2 A G 12: 4,624,982 probably null Het
Kcnk13 A G 12: 99,965,372 probably benign Het
Kdm7a A G 6: 39,170,269 L248P probably damaging Het
Kmt2c T C 5: 25,349,874 E1254G possibly damaging Het
Ldah G A 12: 8,275,912 probably benign Het
Lingo1 T A 9: 56,620,087 D406V possibly damaging Het
Lrriq1 A T 10: 103,215,451 V480E probably benign Het
Mtcl1 C T 17: 66,358,134 R1142H probably benign Het
Mtmr3 G A 11: 4,497,381 Q360* probably null Het
Muc6 T C 7: 141,651,115 N252S probably benign Het
Naa20 T C 2: 145,903,320 L4P probably damaging Het
Neb T A 2: 52,222,961 I4274L probably benign Het
Noa1 A T 5: 77,309,669 F130I probably benign Het
Nrg4 G T 9: 55,236,512 H87N possibly damaging Het
Olfr632 T A 7: 103,937,534 H51Q probably benign Het
P3h3 C T 6: 124,845,601 E536K probably damaging Het
Pcdhb11 T C 18: 37,421,718 S34P probably damaging Het
Pik3r1 T C 13: 101,689,406 T71A possibly damaging Het
Plaur T A 7: 24,466,800 C99S possibly damaging Het
Plekha5 G A 6: 140,586,436 G501E probably damaging Het
Plxnd1 C T 6: 115,977,960 V614M probably benign Het
Ppp2r3a T C 9: 101,148,587 D307G possibly damaging Het
Prl3d3 C T 13: 27,157,470 S28F possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Ptk7 C A 17: 46,572,642 Q832H probably damaging Het
Qser1 T C 2: 104,790,090 S126G probably benign Het
Rab3ip A T 10: 116,915,867 C332S probably damaging Het
Raly C A 2: 154,857,366 T30K probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rps6ka1 C T 4: 133,867,224 M159I possibly damaging Het
Rufy3 C T 5: 88,584,309 T57I probably benign Het
Samd4 A G 14: 47,016,631 D184G probably damaging Het
Slc35f3 T C 8: 126,321,094 C58R possibly damaging Het
Smarca4 T C 9: 21,699,877 I1467T probably damaging Het
Spag17 T G 3: 100,065,585 I1371S probably benign Het
Sptan1 T C 2: 30,007,549 L1228P possibly damaging Het
Stk31 C T 6: 49,421,697 A344V probably benign Het
Supt16 A G 14: 52,170,834 W885R probably damaging Het
Tdrd9 T A 12: 112,025,900 probably null Het
Tmod1 A G 4: 46,078,469 probably null Het
Tnfsf13 A C 11: 69,684,483 probably null Het
Trim75 C A 8: 64,983,442 E119* probably null Het
Wdr6 T C 9: 108,574,911 Y591C probably damaging Het
Wdr86 C T 5: 24,718,283 R137H probably benign Het
Ythdf1 T A 2: 180,911,150 Y424F probably damaging Het
Zfp984 G T 4: 147,756,186 S69R possibly damaging Het
Zyg11a A G 4: 108,181,794 F743L probably damaging Het
Other mutations in Olfr1024
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01632:Olfr1024 APN 2 85904370 missense probably benign
IGL02108:Olfr1024 APN 2 85904150 missense possibly damaging 0.67
IGL02738:Olfr1024 APN 2 85904949 missense probably benign 0.06
IGL03343:Olfr1024 APN 2 85904941 missense probably benign
IGL02802:Olfr1024 UTSW 2 85904389 missense probably damaging 1.00
R0265:Olfr1024 UTSW 2 85904247 missense probably benign 0.01
R0271:Olfr1024 UTSW 2 85904289 missense possibly damaging 0.68
R0432:Olfr1024 UTSW 2 85904157 missense probably damaging 1.00
R0501:Olfr1024 UTSW 2 85905004 missense probably damaging 1.00
R0504:Olfr1024 UTSW 2 85904686 missense possibly damaging 0.95
R1513:Olfr1024 UTSW 2 85904671 missense probably damaging 1.00
R2224:Olfr1024 UTSW 2 85904755 missense probably benign 0.11
R2516:Olfr1024 UTSW 2 85904556 missense probably benign 0.01
R3845:Olfr1024 UTSW 2 85904737 missense probably damaging 0.99
R4871:Olfr1024 UTSW 2 85904371 missense probably benign
R4889:Olfr1024 UTSW 2 85904748 missense possibly damaging 0.48
R4890:Olfr1024 UTSW 2 85904748 missense possibly damaging 0.48
R5543:Olfr1024 UTSW 2 85904328 missense probably damaging 1.00
R5865:Olfr1024 UTSW 2 85904521 missense probably benign 0.00
R6331:Olfr1024 UTSW 2 85904216 missense probably benign 0.32
R6465:Olfr1024 UTSW 2 85904539 missense probably benign 0.05
R7183:Olfr1024 UTSW 2 85904142 missense probably benign 0.00
R7427:Olfr1024 UTSW 2 85904131 nonsense probably null
R7428:Olfr1024 UTSW 2 85904131 nonsense probably null
R7552:Olfr1024 UTSW 2 85904103 missense probably benign 0.01
R7654:Olfr1024 UTSW 2 85904319 missense possibly damaging 0.95
R7674:Olfr1024 UTSW 2 85904536 missense probably damaging 1.00
R7980:Olfr1024 UTSW 2 85904598 missense probably benign 0.22
R8209:Olfr1024 UTSW 2 85904203 missense probably benign 0.14
R8226:Olfr1024 UTSW 2 85904203 missense probably benign 0.14
Z1177:Olfr1024 UTSW 2 85905045 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGCCACAGGTAGATAAAGCC -3'
(R):5'- ACTGAATATTACATGCTGGGTGC -3'

Sequencing Primer
(F):5'- CAGGTAGATAAAGCCTTTCGTTGCC -3'
(R):5'- CATGGCCTATGACAGGTACATGG -3'
Posted On2018-02-28