Incidental Mutation 'R6254:Naa20'
ID505954
Institutional Source Beutler Lab
Gene Symbol Naa20
Ensembl Gene ENSMUSG00000002728
Gene NameN(alpha)-acetyltransferase 20, NatB catalytic subunit
SynonymsD2Ertd186e, 2900026I01Rik, Nat5, 1500004D14Rik
MMRRC Submission 044371-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R6254 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location145902099-145916425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145903320 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 4 (L4P)
Ref Sequence ENSEMBL: ENSMUSP00000127918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002805] [ENSMUST00000110000] [ENSMUST00000134759] [ENSMUST00000149461] [ENSMUST00000150316] [ENSMUST00000165635] [ENSMUST00000169732]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002805
AA Change: L4P

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002805
Gene: ENSMUSG00000002728
AA Change: L4P

DomainStartEndE-ValueType
Pfam:Acetyltransf_7 40 140 2.1e-8 PFAM
Pfam:Acetyltransf_1 48 139 4.3e-15 PFAM
Pfam:FR47 67 148 3.6e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110000
AA Change: L4P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105627
Gene: ENSMUSG00000002728
AA Change: L4P

DomainStartEndE-ValueType
Pfam:Acetyltransf_10 26 128 5.9e-8 PFAM
Pfam:Acetyltransf_7 40 130 5.1e-10 PFAM
Pfam:Acetyltransf_1 48 129 8.3e-18 PFAM
Pfam:FR47 55 138 7.3e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134759
AA Change: L4P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136330
Predicted Effect probably damaging
Transcript: ENSMUST00000149461
AA Change: L4P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127918
Gene: ENSMUSG00000002728
AA Change: L4P

DomainStartEndE-ValueType
SCOP:d1cjwa_ 3 73 5e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150316
Predicted Effect probably damaging
Transcript: ENSMUST00000165635
AA Change: L4P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000169732
AA Change: L4P

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132857
Gene: ENSMUSG00000002728
AA Change: L4P

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 40 112 2.2e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.4%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NAT5 is a component of N-acetyltransferase complex B (NatB). Human NatB performs cotranslational N(alpha)-terminal acetylation of methionine residues when they are followed by asparagine (Starheim et al., 2008 [PubMed 18570629]).[supplied by OMIM, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik A G 8: 13,706,043 D26G possibly damaging Het
Adam6b A T 12: 113,489,570 L2F probably damaging Het
Ank2 T A 3: 126,941,804 probably benign Het
Anpep T G 7: 79,839,233 D369A probably damaging Het
App T C 16: 84,978,177 E599G probably damaging Het
Asphd1 C T 7: 126,948,868 V88I probably benign Het
Atad5 A T 11: 80,127,389 I1389F probably damaging Het
Blm T C 7: 80,480,342 N950S probably benign Het
Bsn A T 9: 108,111,866 M2229K probably damaging Het
Cacna2d2 A G 9: 107,509,216 M181V probably benign Het
Cadps2 T A 6: 23,329,163 probably null Het
Cdh1 T A 8: 106,663,798 V590D probably damaging Het
Cdk5rap2 G A 4: 70,364,032 T160M probably damaging Het
Chrna5 A G 9: 55,006,456 M325V probably benign Het
Clca3a2 A G 3: 144,802,134 I116T probably benign Het
Cyp2c23 T C 19: 44,005,463 K488R probably benign Het
Edil3 T A 13: 89,319,729 I451N probably damaging Het
Exph5 T G 9: 53,372,710 S364A possibly damaging Het
Fam84b A G 15: 60,823,801 I32T probably damaging Het
Fam98c A G 7: 29,154,517 S209P probably damaging Het
Fat3 G A 9: 15,996,145 L2854F probably benign Het
Fbxo38 T C 18: 62,505,500 probably null Het
Fermt2 T C 14: 45,476,059 D205G probably damaging Het
Fmnl1 G A 11: 103,196,315 probably benign Het
Fn3k A G 11: 121,435,068 E27G probably damaging Het
Foxj2 A G 6: 122,838,139 H378R probably damaging Het
Fubp1 A G 3: 152,232,408 K140E possibly damaging Het
Gm4788 A G 1: 139,754,390 I156T probably damaging Het
Gm7694 A T 1: 170,302,534 C98* probably null Het
Golgb1 T C 16: 36,913,978 S1196P probably damaging Het
Gpm6a G A 8: 55,047,396 probably null Het
Hltf T A 3: 20,063,829 N80K possibly damaging Het
Il1rap G A 16: 26,695,270 R251H probably benign Het
Ipo7 T A 7: 110,049,060 D688E probably benign Het
Itgal T A 7: 127,325,203 N897K probably damaging Het
Itsn2 A G 12: 4,624,982 probably null Het
Kcnk13 A G 12: 99,965,372 probably benign Het
Kdm7a A G 6: 39,170,269 L248P probably damaging Het
Kmt2c T C 5: 25,349,874 E1254G possibly damaging Het
Ldah G A 12: 8,275,912 probably benign Het
Lingo1 T A 9: 56,620,087 D406V possibly damaging Het
Lrriq1 A T 10: 103,215,451 V480E probably benign Het
Mtcl1 C T 17: 66,358,134 R1142H probably benign Het
Mtmr3 G A 11: 4,497,381 Q360* probably null Het
Muc6 T C 7: 141,651,115 N252S probably benign Het
Neb T A 2: 52,222,961 I4274L probably benign Het
Noa1 A T 5: 77,309,669 F130I probably benign Het
Nrg4 G T 9: 55,236,512 H87N possibly damaging Het
Olfr1024 T A 2: 85,904,505 Y183F probably damaging Het
Olfr632 T A 7: 103,937,534 H51Q probably benign Het
P3h3 C T 6: 124,845,601 E536K probably damaging Het
Pcdhb11 T C 18: 37,421,718 S34P probably damaging Het
Pik3r1 T C 13: 101,689,406 T71A possibly damaging Het
Plaur T A 7: 24,466,800 C99S possibly damaging Het
Plekha5 G A 6: 140,586,436 G501E probably damaging Het
Plxnd1 C T 6: 115,977,960 V614M probably benign Het
Ppp2r3a T C 9: 101,148,587 D307G possibly damaging Het
Prl3d3 C T 13: 27,157,470 S28F possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Ptk7 C A 17: 46,572,642 Q832H probably damaging Het
Qser1 T C 2: 104,790,090 S126G probably benign Het
Rab3ip A T 10: 116,915,867 C332S probably damaging Het
Raly C A 2: 154,857,366 T30K probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rps6ka1 C T 4: 133,867,224 M159I possibly damaging Het
Rufy3 C T 5: 88,584,309 T57I probably benign Het
Samd4 A G 14: 47,016,631 D184G probably damaging Het
Slc35f3 T C 8: 126,321,094 C58R possibly damaging Het
Smarca4 T C 9: 21,699,877 I1467T probably damaging Het
Spag17 T G 3: 100,065,585 I1371S probably benign Het
Sptan1 T C 2: 30,007,549 L1228P possibly damaging Het
Stk31 C T 6: 49,421,697 A344V probably benign Het
Supt16 A G 14: 52,170,834 W885R probably damaging Het
Tdrd9 T A 12: 112,025,900 probably null Het
Tmod1 A G 4: 46,078,469 probably null Het
Tnfsf13 A C 11: 69,684,483 probably null Het
Trim75 C A 8: 64,983,442 E119* probably null Het
Wdr6 T C 9: 108,574,911 Y591C probably damaging Het
Wdr86 C T 5: 24,718,283 R137H probably benign Het
Ythdf1 T A 2: 180,911,150 Y424F probably damaging Het
Zfp984 G T 4: 147,756,186 S69R possibly damaging Het
Zyg11a A G 4: 108,181,794 F743L probably damaging Het
Other mutations in Naa20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Naa20 APN 2 145915806 unclassified probably null
IGL03205:Naa20 APN 2 145903331 missense possibly damaging 0.66
R0485:Naa20 UTSW 2 145915672 missense probably damaging 1.00
R1537:Naa20 UTSW 2 145912518 missense probably benign 0.01
R2161:Naa20 UTSW 2 145911795 critical splice donor site probably null
R4651:Naa20 UTSW 2 145911832 intron probably benign
R5044:Naa20 UTSW 2 145915842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATTTCAGCCGCCAGAGAG -3'
(R):5'- CACTGGGATACAATTTAACCAGG -3'

Sequencing Primer
(F):5'- AGAGAGCTACGACGCTACTCTTG -3'
(R):5'- TTTAACCAGGACCGCGCTC -3'
Posted On2018-02-28