Mutagenetix > Incidental Mutations

Incidental Mutation 'R6254:Hltf'

505957

Institutional Source

Beutler Lab

Gene Symbol

Hltf

Ensembl Gene

ENSMUSG00000002428

Gene Name

helicase-like transcription factor

Synonyms

P113, Snf2l3, Smarca3

MMRRC Submission

044371-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6254 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20057811-20118490 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 20063829 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 80 (N80K)

Ref Sequence

ENSEMBL: ENSMUSP00000002502 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002502] [ENSMUST00000143005] [ENSMUST00000145853]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000002502
AA Change: N80K

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000002502
Gene: ENSMUSG00000002428
AA Change: N80K

Domain	Start	End	E-Value	Type
HIRAN	60	154	3.78e-29	SMART
DEXDc	236	608	1.26e-32	SMART
RING	754	794	4.41e-6	SMART
low complexity region	814	828	N/A	INTRINSIC
HELICc	859	944	2.24e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128127

Predicted Effect

possibly damaging
Transcript: ENSMUST00000143005
AA Change: N80K

PolyPhen 2 Score 0.738 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000116570
Gene: ENSMUSG00000002428
AA Change: N80K

Domain	Start	End	E-Value	Type
HIRAN	60	154	3.78e-29	SMART
DEXDc	236	610	2.36e-23	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000145853
AA Change: N18K

PolyPhen 2 Score 0.738 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000118775
Gene: ENSMUSG00000002428
AA Change: N18K

Domain	Start	End	E-Value	Type
HIRAN	1	92	2.7e-25	SMART
DEXDc	174	548	2.36e-23	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154233

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.4%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI/SNF family. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein contains a RING finger DNA binding motif. Two transcript variants encoding the same protein have been found for this gene. However, use of an alternative translation start site produces an isoform that is truncated at the N-terminus compared to the full-length protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, spongiform encephalopathy with increased brain apoptosis, and hypoglycemia. Mice homozygous for a different knock-out allele fail to show fluoxetine-induced neurogenesis and behavioral responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932443I19Rik	A	G	8: 13,706,043	D26G	possibly damaging	Het
Adam6b	A	T	12: 113,489,570	L2F	probably damaging	Het
Ank2	T	A	3: 126,941,804		probably benign	Het
Anpep	T	G	7: 79,839,233	D369A	probably damaging	Het
App	T	C	16: 84,978,177	E599G	probably damaging	Het
Asphd1	C	T	7: 126,948,868	V88I	probably benign	Het
Atad5	A	T	11: 80,127,389	I1389F	probably damaging	Het
Blm	T	C	7: 80,480,342	N950S	probably benign	Het
Bsn	A	T	9: 108,111,866	M2229K	probably damaging	Het
Cacna2d2	A	G	9: 107,509,216	M181V	probably benign	Het
Cadps2	T	A	6: 23,329,163		probably null	Het
Cdh1	T	A	8: 106,663,798	V590D	probably damaging	Het
Cdk5rap2	G	A	4: 70,364,032	T160M	probably damaging	Het
Chrna5	A	G	9: 55,006,456	M325V	probably benign	Het
Clca3a2	A	G	3: 144,802,134	I116T	probably benign	Het
Cyp2c23	T	C	19: 44,005,463	K488R	probably benign	Het
Edil3	T	A	13: 89,319,729	I451N	probably damaging	Het
Exph5	T	G	9: 53,372,710	S364A	possibly damaging	Het
Fam84b	A	G	15: 60,823,801	I32T	probably damaging	Het
Fam98c	A	G	7: 29,154,517	S209P	probably damaging	Het
Fat3	G	A	9: 15,996,145	L2854F	probably benign	Het
Fbxo38	T	C	18: 62,505,500		probably null	Het
Fermt2	T	C	14: 45,476,059	D205G	probably damaging	Het
Fmnl1	G	A	11: 103,196,315		probably benign	Het
Fn3k	A	G	11: 121,435,068	E27G	probably damaging	Het
Foxj2	A	G	6: 122,838,139	H378R	probably damaging	Het
Fubp1	A	G	3: 152,232,408	K140E	possibly damaging	Het
Gm4788	A	G	1: 139,754,390	I156T	probably damaging	Het
Gm7694	A	T	1: 170,302,534	C98*	probably null	Het
Golgb1	T	C	16: 36,913,978	S1196P	probably damaging	Het
Gpm6a	G	A	8: 55,047,396		probably null	Het
Il1rap	G	A	16: 26,695,270	R251H	probably benign	Het
Ipo7	T	A	7: 110,049,060	D688E	probably benign	Het
Itgal	T	A	7: 127,325,203	N897K	probably damaging	Het
Itsn2	A	G	12: 4,624,982		probably null	Het
Kcnk13	A	G	12: 99,965,372		probably benign	Het
Kdm7a	A	G	6: 39,170,269	L248P	probably damaging	Het
Kmt2c	T	C	5: 25,349,874	E1254G	possibly damaging	Het
Ldah	G	A	12: 8,275,912		probably benign	Het
Lingo1	T	A	9: 56,620,087	D406V	possibly damaging	Het
Lrriq1	A	T	10: 103,215,451	V480E	probably benign	Het
Mtcl1	C	T	17: 66,358,134	R1142H	probably benign	Het
Mtmr3	G	A	11: 4,497,381	Q360*	probably null	Het
Muc6	T	C	7: 141,651,115	N252S	probably benign	Het
Naa20	T	C	2: 145,903,320	L4P	probably damaging	Het
Neb	T	A	2: 52,222,961	I4274L	probably benign	Het
Noa1	A	T	5: 77,309,669	F130I	probably benign	Het
Nrg4	G	T	9: 55,236,512	H87N	possibly damaging	Het
Olfr1024	T	A	2: 85,904,505	Y183F	probably damaging	Het
Olfr632	T	A	7: 103,937,534	H51Q	probably benign	Het
P3h3	C	T	6: 124,845,601	E536K	probably damaging	Het
Pcdhb11	T	C	18: 37,421,718	S34P	probably damaging	Het
Pik3r1	T	C	13: 101,689,406	T71A	possibly damaging	Het
Plaur	T	A	7: 24,466,800	C99S	possibly damaging	Het
Plekha5	G	A	6: 140,586,436	G501E	probably damaging	Het
Plxnd1	C	T	6: 115,977,960	V614M	probably benign	Het
Ppp2r3a	T	C	9: 101,148,587	D307G	possibly damaging	Het
Prl3d3	C	T	13: 27,157,470	S28F	possibly damaging	Het
Prpf40a	T	C	2: 53,157,915	M197V	probably benign	Het
Ptk7	C	A	17: 46,572,642	Q832H	probably damaging	Het
Qser1	T	C	2: 104,790,090	S126G	probably benign	Het
Rab3ip	A	T	10: 116,915,867	C332S	probably damaging	Het
Raly	C	A	2: 154,857,366	T30K	probably damaging	Het
Rbp2	G	T	9: 98,490,647	S13I	probably benign	Het
Rps6ka1	C	T	4: 133,867,224	M159I	possibly damaging	Het
Rufy3	C	T	5: 88,584,309	T57I	probably benign	Het
Samd4	A	G	14: 47,016,631	D184G	probably damaging	Het
Slc35f3	T	C	8: 126,321,094	C58R	possibly damaging	Het
Smarca4	T	C	9: 21,699,877	I1467T	probably damaging	Het
Spag17	T	G	3: 100,065,585	I1371S	probably benign	Het
Sptan1	T	C	2: 30,007,549	L1228P	possibly damaging	Het
Stk31	C	T	6: 49,421,697	A344V	probably benign	Het
Supt16	A	G	14: 52,170,834	W885R	probably damaging	Het
Tdrd9	T	A	12: 112,025,900		probably null	Het
Tmod1	A	G	4: 46,078,469		probably null	Het
Tnfsf13	A	C	11: 69,684,483		probably null	Het
Trim75	C	A	8: 64,983,442	E119*	probably null	Het
Wdr6	T	C	9: 108,574,911	Y591C	probably damaging	Het
Wdr86	C	T	5: 24,718,283	R137H	probably benign	Het
Ythdf1	T	A	2: 180,911,150	Y424F	probably damaging	Het
Zfp984	G	T	4: 147,756,186	S69R	possibly damaging	Het
Zyg11a	A	G	4: 108,181,794	F743L	probably damaging	Het

Other mutations in Hltf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00650:Hltf	APN	3	20105632	splice site	probably benign
IGL01461:Hltf	APN	3	20099939	nonsense	probably null
IGL01630:Hltf	APN	3	20082904	splice site	probably benign
IGL01704:Hltf	APN	3	20083746	splice site	probably benign
IGL02059:Hltf	APN	3	20106457	missense	probably benign
IGL02105:Hltf	APN	3	20092757	missense	probably damaging	1.00
IGL02156:Hltf	APN	3	20092807	missense	possibly damaging	0.61
IGL02870:Hltf	APN	3	20099873	missense	probably damaging	0.98
IGL02899:Hltf	APN	3	20099817	missense	probably damaging	1.00
IGL02935:Hltf	APN	3	20069051	missense	probably damaging	1.00
IGL02950:Hltf	APN	3	20076572	missense	probably benign	0.07
IGL03082:Hltf	APN	3	20064559	splice site	probably benign
snarky	UTSW	3	20109487	critical splice donor site	probably null
R0068:Hltf	UTSW	3	20059090	missense	probably damaging	1.00
R0787:Hltf	UTSW	3	20106446	missense	probably damaging	1.00
R0905:Hltf	UTSW	3	20108869	critical splice donor site	probably null
R0980:Hltf	UTSW	3	20091501	missense	probably benign	0.00
R1741:Hltf	UTSW	3	20086188	missense	probably damaging	1.00
R1748:Hltf	UTSW	3	20076521	missense	probably benign	0.13
R1799:Hltf	UTSW	3	20105691	missense	probably damaging	1.00
R1976:Hltf	UTSW	3	20106446	missense	probably damaging	1.00
R2171:Hltf	UTSW	3	20059081	missense	probably damaging	1.00
R2395:Hltf	UTSW	3	20092742	missense	probably benign	0.41
R2444:Hltf	UTSW	3	20063907	missense	possibly damaging	0.66
R3789:Hltf	UTSW	3	20069047	missense	probably damaging	1.00
R3943:Hltf	UTSW	3	20092744	missense	probably damaging	1.00
R4719:Hltf	UTSW	3	20064701	critical splice donor site	probably null
R4793:Hltf	UTSW	3	20063950	missense	possibly damaging	0.79
R5296:Hltf	UTSW	3	20108112	missense	probably damaging	0.99
R5449:Hltf	UTSW	3	20069083	missense	possibly damaging	0.92
R5492:Hltf	UTSW	3	20098067	splice site	probably null
R6012:Hltf	UTSW	3	20058934	missense	probably damaging	1.00
R6157:Hltf	UTSW	3	20076496	missense	probably benign	0.13
R6553:Hltf	UTSW	3	20072394	missense	probably damaging	0.96
R6616:Hltf	UTSW	3	20109487	critical splice donor site	probably null
R6696:Hltf	UTSW	3	20065306	splice site	probably null
R6761:Hltf	UTSW	3	20083832	critical splice donor site	probably null
R6781:Hltf	UTSW	3	20098166	missense	probably benign	0.00
R7241:Hltf	UTSW	3	20065392	missense	probably benign	0.07
R7356:Hltf	UTSW	3	20109370	missense	probably damaging	1.00
R7453:Hltf	UTSW	3	20082752	missense	possibly damaging	0.81
R7765:Hltf	UTSW	3	20091483	missense	probably benign	0.02
R7978:Hltf	UTSW	3	20092804	missense	probably damaging	1.00
R8299:Hltf	UTSW	3	20082822	missense	possibly damaging	0.73
R8547:Hltf	UTSW	3	20098127	missense	probably damaging	1.00
X0027:Hltf	UTSW	3	20067389	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CCTCTTGAACAATATAGGGCGAATG -3'
(R):5'- GGGGCTCCAAAAGTGATAACATATTC -3'

Sequencing Primer
(F):5'- GACTGCATATCTAACTTGAGGCCAG -3'
(R):5'- ACCACAAGGATTAAACTCTAAAAGC -3'

Posted On

2018-02-28