Incidental Mutation 'R6254:Fubp1'
ID505961
Institutional Source Beutler Lab
Gene Symbol Fubp1
Ensembl Gene ENSMUSG00000028034
Gene Namefar upstream element (FUSE) binding protein 1
Synonyms9530027K12Rik, FBP, Fubp, Fubp4
MMRRC Submission 044371-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6254 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location152210422-152236826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152232408 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 140 (K140E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046045] [ENSMUST00000106121] [ENSMUST00000166984] [ENSMUST00000196695] [ENSMUST00000196739] [ENSMUST00000199470] [ENSMUST00000199876] [ENSMUST00000200452] [ENSMUST00000200524]
Predicted Effect probably benign
Transcript: ENSMUST00000046045
SMART Domains Protein: ENSMUSP00000037120
Gene: ENSMUSG00000039103

DomainStartEndE-ValueType
coiled coil region 40 92 N/A INTRINSIC
coiled coil region 176 358 N/A INTRINSIC
coiled coil region 391 419 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
low complexity region 487 493 N/A INTRINSIC
IG 519 603 4.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106121
SMART Domains Protein: ENSMUSP00000101727
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 94 164 1.09e-17 SMART
KH 179 251 2.33e-17 SMART
KH 269 339 1.32e-16 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 1.19e-14 SMART
low complexity region 513 527 N/A INTRINSIC
low complexity region 530 556 N/A INTRINSIC
Pfam:DUF1897 571 599 1.3e-7 PFAM
Pfam:DUF1897 600 624 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166984
SMART Domains Protein: ENSMUSP00000130145
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 94 164 1.09e-17 SMART
KH 179 251 2.33e-17 SMART
KH 269 339 1.32e-16 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 1.19e-14 SMART
low complexity region 513 527 N/A INTRINSIC
low complexity region 530 556 N/A INTRINSIC
Pfam:DUF1897 570 598 2e-7 PFAM
Pfam:DUF1897 599 631 9.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196695
SMART Domains Protein: ENSMUSP00000143729
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 95 165 7e-20 SMART
KH 180 252 1.5e-19 SMART
KH 270 340 8.2e-19 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 7.3e-17 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 572 600 1.1e-4 PFAM
Pfam:DUF1897 601 625 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196739
SMART Domains Protein: ENSMUSP00000143101
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 2e-8 PDB
KH 95 165 1.09e-17 SMART
KH 180 252 2.33e-17 SMART
KH 270 340 1.32e-16 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 1.19e-14 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 568 596 1e-7 PFAM
Pfam:DUF1897 597 629 4.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198046
Predicted Effect possibly damaging
Transcript: ENSMUST00000198405
AA Change: K140E

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198539
Predicted Effect probably benign
Transcript: ENSMUST00000199470
SMART Domains Protein: ENSMUSP00000143133
Gene: ENSMUSG00000039103

DomainStartEndE-ValueType
internal_repeat_1 14 35 5.77e-6 PROSPERO
low complexity region 36 53 N/A INTRINSIC
internal_repeat_1 86 106 5.77e-6 PROSPERO
low complexity region 108 131 N/A INTRINSIC
low complexity region 176 210 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
coiled coil region 321 349 N/A INTRINSIC
coiled coil region 372 423 N/A INTRINSIC
IG 449 533 2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199876
SMART Domains Protein: ENSMUSP00000143618
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 95 165 1.09e-17 SMART
KH 180 252 2.33e-17 SMART
KH 270 340 1.32e-16 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 1.19e-14 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 572 600 1.5e-7 PFAM
Pfam:DUF1897 601 625 1.5e-9 PFAM
transmembrane domain 654 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199918
Predicted Effect probably benign
Transcript: ENSMUST00000200452
SMART Domains Protein: ENSMUSP00000143019
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 94 164 1.09e-17 SMART
KH 179 251 2.33e-17 SMART
KH 269 339 1.32e-16 SMART
low complexity region 344 366 N/A INTRINSIC
KH 370 443 1.19e-14 SMART
low complexity region 513 527 N/A INTRINSIC
low complexity region 530 556 N/A INTRINSIC
Pfam:DUF1897 570 598 2e-7 PFAM
Pfam:DUF1897 599 631 9.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200524
SMART Domains Protein: ENSMUSP00000143354
Gene: ENSMUSG00000028034

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
PDB:2KXH|B 24 48 3e-8 PDB
KH 95 165 6.9e-20 SMART
KH 180 252 1.5e-19 SMART
KH 270 340 8.1e-19 SMART
low complexity region 345 367 N/A INTRINSIC
KH 371 444 7.2e-17 SMART
low complexity region 514 528 N/A INTRINSIC
low complexity region 531 557 N/A INTRINSIC
Pfam:DUF1897 571 599 1.5e-4 PFAM
Pfam:DUF1897 600 632 7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200207
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.4%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single stranded DNA-binding protein that binds to multiple DNA elements, including the far upstream element (FUSE) located upstream of c-myc. Binding to FUSE occurs on the non-coding strand, and is important to the regulation of c-myc in undifferentiated cells. This protein contains three domains, an amphipathic helix N-terminal domain, a DNA-binding central domain, and a C-terminal transactivation domain that contains three tyrosine-rich motifs. The N-terminal domain is thought to repress the activity of the C-terminal domain. This protein is also thought to bind RNA, and contains 3'-5' helicase activity with in vitro activity on both DNA-DNA and RNA-RNA duplexes. Aberrant expression of this gene has been found in malignant tissues, and this gene is important to neural system and lung development. Binding of this protein to viral RNA is thought to play a role in several viral diseases, including hepatitis C and hand, foot and mouth disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit pre- and perinatal lethality, cerebral hyperplasia, pale liver, hypoplastic lungs, spleen, thymus and bone marrow, cardiac hypertrophy, placental distress, small size, and anemia associated with variable, multilineage hematopoietic deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik A G 8: 13,706,043 D26G possibly damaging Het
Adam6b A T 12: 113,489,570 L2F probably damaging Het
Ank2 T A 3: 126,941,804 probably benign Het
Anpep T G 7: 79,839,233 D369A probably damaging Het
App T C 16: 84,978,177 E599G probably damaging Het
Asphd1 C T 7: 126,948,868 V88I probably benign Het
Atad5 A T 11: 80,127,389 I1389F probably damaging Het
Blm T C 7: 80,480,342 N950S probably benign Het
Bsn A T 9: 108,111,866 M2229K probably damaging Het
Cacna2d2 A G 9: 107,509,216 M181V probably benign Het
Cadps2 T A 6: 23,329,163 probably null Het
Cdh1 T A 8: 106,663,798 V590D probably damaging Het
Cdk5rap2 G A 4: 70,364,032 T160M probably damaging Het
Chrna5 A G 9: 55,006,456 M325V probably benign Het
Clca3a2 A G 3: 144,802,134 I116T probably benign Het
Cyp2c23 T C 19: 44,005,463 K488R probably benign Het
Edil3 T A 13: 89,319,729 I451N probably damaging Het
Exph5 T G 9: 53,372,710 S364A possibly damaging Het
Fam84b A G 15: 60,823,801 I32T probably damaging Het
Fam98c A G 7: 29,154,517 S209P probably damaging Het
Fat3 G A 9: 15,996,145 L2854F probably benign Het
Fbxo38 T C 18: 62,505,500 probably null Het
Fermt2 T C 14: 45,476,059 D205G probably damaging Het
Fmnl1 G A 11: 103,196,315 probably benign Het
Fn3k A G 11: 121,435,068 E27G probably damaging Het
Foxj2 A G 6: 122,838,139 H378R probably damaging Het
Gm4788 A G 1: 139,754,390 I156T probably damaging Het
Gm7694 A T 1: 170,302,534 C98* probably null Het
Golgb1 T C 16: 36,913,978 S1196P probably damaging Het
Gpm6a G A 8: 55,047,396 probably null Het
Hltf T A 3: 20,063,829 N80K possibly damaging Het
Il1rap G A 16: 26,695,270 R251H probably benign Het
Ipo7 T A 7: 110,049,060 D688E probably benign Het
Itgal T A 7: 127,325,203 N897K probably damaging Het
Itsn2 A G 12: 4,624,982 probably null Het
Kcnk13 A G 12: 99,965,372 probably benign Het
Kdm7a A G 6: 39,170,269 L248P probably damaging Het
Kmt2c T C 5: 25,349,874 E1254G possibly damaging Het
Ldah G A 12: 8,275,912 probably benign Het
Lingo1 T A 9: 56,620,087 D406V possibly damaging Het
Lrriq1 A T 10: 103,215,451 V480E probably benign Het
Mtcl1 C T 17: 66,358,134 R1142H probably benign Het
Mtmr3 G A 11: 4,497,381 Q360* probably null Het
Muc6 T C 7: 141,651,115 N252S probably benign Het
Naa20 T C 2: 145,903,320 L4P probably damaging Het
Neb T A 2: 52,222,961 I4274L probably benign Het
Noa1 A T 5: 77,309,669 F130I probably benign Het
Nrg4 G T 9: 55,236,512 H87N possibly damaging Het
Olfr1024 T A 2: 85,904,505 Y183F probably damaging Het
Olfr632 T A 7: 103,937,534 H51Q probably benign Het
P3h3 C T 6: 124,845,601 E536K probably damaging Het
Pcdhb11 T C 18: 37,421,718 S34P probably damaging Het
Pik3r1 T C 13: 101,689,406 T71A possibly damaging Het
Plaur T A 7: 24,466,800 C99S possibly damaging Het
Plekha5 G A 6: 140,586,436 G501E probably damaging Het
Plxnd1 C T 6: 115,977,960 V614M probably benign Het
Ppp2r3a T C 9: 101,148,587 D307G possibly damaging Het
Prl3d3 C T 13: 27,157,470 S28F possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Ptk7 C A 17: 46,572,642 Q832H probably damaging Het
Qser1 T C 2: 104,790,090 S126G probably benign Het
Rab3ip A T 10: 116,915,867 C332S probably damaging Het
Raly C A 2: 154,857,366 T30K probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rps6ka1 C T 4: 133,867,224 M159I possibly damaging Het
Rufy3 C T 5: 88,584,309 T57I probably benign Het
Samd4 A G 14: 47,016,631 D184G probably damaging Het
Slc35f3 T C 8: 126,321,094 C58R possibly damaging Het
Smarca4 T C 9: 21,699,877 I1467T probably damaging Het
Spag17 T G 3: 100,065,585 I1371S probably benign Het
Sptan1 T C 2: 30,007,549 L1228P possibly damaging Het
Stk31 C T 6: 49,421,697 A344V probably benign Het
Supt16 A G 14: 52,170,834 W885R probably damaging Het
Tdrd9 T A 12: 112,025,900 probably null Het
Tmod1 A G 4: 46,078,469 probably null Het
Tnfsf13 A C 11: 69,684,483 probably null Het
Trim75 C A 8: 64,983,442 E119* probably null Het
Wdr6 T C 9: 108,574,911 Y591C probably damaging Het
Wdr86 C T 5: 24,718,283 R137H probably benign Het
Ythdf1 T A 2: 180,911,150 Y424F probably damaging Het
Zfp984 G T 4: 147,756,186 S69R possibly damaging Het
Zyg11a A G 4: 108,181,794 F743L probably damaging Het
Other mutations in Fubp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Fubp1 APN 3 152222234 missense probably damaging 0.97
IGL01328:Fubp1 APN 3 152220218 missense probably damaging 1.00
IGL01583:Fubp1 APN 3 152215624 missense possibly damaging 0.71
IGL02886:Fubp1 APN 3 152220755 missense possibly damaging 0.90
R0166:Fubp1 UTSW 3 152220204 nonsense probably null
R0268:Fubp1 UTSW 3 152219713 missense probably damaging 0.99
R0344:Fubp1 UTSW 3 152219713 missense probably damaging 0.99
R0759:Fubp1 UTSW 3 152210637 small insertion probably benign
R1159:Fubp1 UTSW 3 152215592 missense possibly damaging 0.93
R1194:Fubp1 UTSW 3 152231969 frame shift probably null
R1687:Fubp1 UTSW 3 152228201 unclassified probably benign
R1818:Fubp1 UTSW 3 152222169 missense probably damaging 1.00
R3880:Fubp1 UTSW 3 152220496 missense probably damaging 1.00
R4247:Fubp1 UTSW 3 152231936 missense possibly damaging 0.92
R4564:Fubp1 UTSW 3 152222936 nonsense probably null
R4776:Fubp1 UTSW 3 152222068 splice site probably null
R4793:Fubp1 UTSW 3 152223329 missense possibly damaging 0.86
R4825:Fubp1 UTSW 3 152217890 splice site probably null
R5035:Fubp1 UTSW 3 152214851 missense probably benign 0.01
R5167:Fubp1 UTSW 3 152221352 missense possibly damaging 0.67
R5819:Fubp1 UTSW 3 152220553 missense probably damaging 1.00
R5892:Fubp1 UTSW 3 152218314 intron probably benign
R6814:Fubp1 UTSW 3 152226146 missense probably benign 0.33
R6872:Fubp1 UTSW 3 152226146 missense probably benign 0.33
R7132:Fubp1 UTSW 3 152232024 critical splice donor site probably null
R7612:Fubp1 UTSW 3 152218015 missense possibly damaging 0.66
R7876:Fubp1 UTSW 3 152232291 missense unknown
R7903:Fubp1 UTSW 3 152214861 nonsense probably null
R7969:Fubp1 UTSW 3 152222246 critical splice donor site probably null
R8201:Fubp1 UTSW 3 152222186 missense probably damaging 1.00
R8219:Fubp1 UTSW 3 152220466 missense probably damaging 1.00
R8262:Fubp1 UTSW 3 152220719 missense probably damaging 1.00
R8434:Fubp1 UTSW 3 152220553 missense probably damaging 1.00
Z1176:Fubp1 UTSW 3 152222087 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAATGTTTTCTGGCATCTGAGTGC -3'
(R):5'- AAGCATCGACCACATAATAGTTGC -3'

Sequencing Primer
(F):5'- CATCTGAGTGCTATTTTTGTAATGCC -3'
(R):5'- CATTTGCTGGAATGTGTACATCTAC -3'
Posted On2018-02-28