Incidental Mutation 'R6254:Zyg11a'
ID505964
Institutional Source Beutler Lab
Gene Symbol Zyg11a
Ensembl Gene ENSMUSG00000034645
Gene Namezyg-11 family member A, cell cycle regulator
Synonyms
MMRRC Submission 044371-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R6254 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location108181738-108218048 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108181794 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 743 (F743L)
Ref Sequence ENSEMBL: ENSMUSP00000152477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043793] [ENSMUST00000052999] [ENSMUST00000106690] [ENSMUST00000116307] [ENSMUST00000116309] [ENSMUST00000125647] [ENSMUST00000126900] [ENSMUST00000130942] [ENSMUST00000223127]
Predicted Effect probably benign
Transcript: ENSMUST00000043793
SMART Domains Protein: ENSMUSP00000038478
Gene: ENSMUSG00000034645

DomainStartEndE-ValueType
SCOP:d1jdha_ 218 700 2e-11 SMART
Blast:ARM 497 544 1e-5 BLAST
Blast:ARM 547 587 5e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000052999
SMART Domains Protein: ENSMUSP00000051268
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
Pfam:ECH_1 41 296 1.1e-60 PFAM
Pfam:ECH_2 46 225 5.1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106690
SMART Domains Protein: ENSMUSP00000102301
Gene: ENSMUSG00000034645

DomainStartEndE-ValueType
SCOP:d1jdha_ 139 621 1e-11 SMART
Blast:ARM 418 465 1e-5 BLAST
Blast:ARM 468 508 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106691
SMART Domains Protein: ENSMUSP00000102302
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
Pfam:ECH_1 1 119 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116307
SMART Domains Protein: ENSMUSP00000112009
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
Pfam:ECH 39 131 6.7e-17 PFAM
Pfam:ECH 124 257 5.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116309
SMART Domains Protein: ENSMUSP00000112011
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
Pfam:ECH 39 288 3.2e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125647
SMART Domains Protein: ENSMUSP00000123913
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
low complexity region 45 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127392
Predicted Effect probably benign
Transcript: ENSMUST00000130942
SMART Domains Protein: ENSMUSP00000124746
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
Pfam:ECH 39 103 8.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133049
Predicted Effect probably benign
Transcript: ENSMUST00000135718
SMART Domains Protein: ENSMUSP00000114371
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
Pfam:ECH_1 1 74 9.6e-16 PFAM
Pfam:ECH_2 2 74 1.1e-11 PFAM
Pfam:ECH_1 69 184 2.8e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150487
Predicted Effect probably damaging
Transcript: ENSMUST00000223127
AA Change: F743L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.4%
Validation Efficiency 100% (82/82)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik A G 8: 13,706,043 D26G possibly damaging Het
Adam6b A T 12: 113,489,570 L2F probably damaging Het
Ank2 T A 3: 126,941,804 probably benign Het
Anpep T G 7: 79,839,233 D369A probably damaging Het
App T C 16: 84,978,177 E599G probably damaging Het
Asphd1 C T 7: 126,948,868 V88I probably benign Het
Atad5 A T 11: 80,127,389 I1389F probably damaging Het
Blm T C 7: 80,480,342 N950S probably benign Het
Bsn A T 9: 108,111,866 M2229K probably damaging Het
Cacna2d2 A G 9: 107,509,216 M181V probably benign Het
Cadps2 T A 6: 23,329,163 probably null Het
Cdh1 T A 8: 106,663,798 V590D probably damaging Het
Cdk5rap2 G A 4: 70,364,032 T160M probably damaging Het
Chrna5 A G 9: 55,006,456 M325V probably benign Het
Clca3a2 A G 3: 144,802,134 I116T probably benign Het
Cyp2c23 T C 19: 44,005,463 K488R probably benign Het
Edil3 T A 13: 89,319,729 I451N probably damaging Het
Exph5 T G 9: 53,372,710 S364A possibly damaging Het
Fam84b A G 15: 60,823,801 I32T probably damaging Het
Fam98c A G 7: 29,154,517 S209P probably damaging Het
Fat3 G A 9: 15,996,145 L2854F probably benign Het
Fbxo38 T C 18: 62,505,500 probably null Het
Fermt2 T C 14: 45,476,059 D205G probably damaging Het
Fmnl1 G A 11: 103,196,315 probably benign Het
Fn3k A G 11: 121,435,068 E27G probably damaging Het
Foxj2 A G 6: 122,838,139 H378R probably damaging Het
Fubp1 A G 3: 152,232,408 K140E possibly damaging Het
Gm4788 A G 1: 139,754,390 I156T probably damaging Het
Gm7694 A T 1: 170,302,534 C98* probably null Het
Golgb1 T C 16: 36,913,978 S1196P probably damaging Het
Gpm6a G A 8: 55,047,396 probably null Het
Hltf T A 3: 20,063,829 N80K possibly damaging Het
Il1rap G A 16: 26,695,270 R251H probably benign Het
Ipo7 T A 7: 110,049,060 D688E probably benign Het
Itgal T A 7: 127,325,203 N897K probably damaging Het
Itsn2 A G 12: 4,624,982 probably null Het
Kcnk13 A G 12: 99,965,372 probably benign Het
Kdm7a A G 6: 39,170,269 L248P probably damaging Het
Kmt2c T C 5: 25,349,874 E1254G possibly damaging Het
Ldah G A 12: 8,275,912 probably benign Het
Lingo1 T A 9: 56,620,087 D406V possibly damaging Het
Lrriq1 A T 10: 103,215,451 V480E probably benign Het
Mtcl1 C T 17: 66,358,134 R1142H probably benign Het
Mtmr3 G A 11: 4,497,381 Q360* probably null Het
Muc6 T C 7: 141,651,115 N252S probably benign Het
Naa20 T C 2: 145,903,320 L4P probably damaging Het
Neb T A 2: 52,222,961 I4274L probably benign Het
Noa1 A T 5: 77,309,669 F130I probably benign Het
Nrg4 G T 9: 55,236,512 H87N possibly damaging Het
Olfr1024 T A 2: 85,904,505 Y183F probably damaging Het
Olfr632 T A 7: 103,937,534 H51Q probably benign Het
P3h3 C T 6: 124,845,601 E536K probably damaging Het
Pcdhb11 T C 18: 37,421,718 S34P probably damaging Het
Pik3r1 T C 13: 101,689,406 T71A possibly damaging Het
Plaur T A 7: 24,466,800 C99S possibly damaging Het
Plekha5 G A 6: 140,586,436 G501E probably damaging Het
Plxnd1 C T 6: 115,977,960 V614M probably benign Het
Ppp2r3a T C 9: 101,148,587 D307G possibly damaging Het
Prl3d3 C T 13: 27,157,470 S28F possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Ptk7 C A 17: 46,572,642 Q832H probably damaging Het
Qser1 T C 2: 104,790,090 S126G probably benign Het
Rab3ip A T 10: 116,915,867 C332S probably damaging Het
Raly C A 2: 154,857,366 T30K probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rps6ka1 C T 4: 133,867,224 M159I possibly damaging Het
Rufy3 C T 5: 88,584,309 T57I probably benign Het
Samd4 A G 14: 47,016,631 D184G probably damaging Het
Slc35f3 T C 8: 126,321,094 C58R possibly damaging Het
Smarca4 T C 9: 21,699,877 I1467T probably damaging Het
Spag17 T G 3: 100,065,585 I1371S probably benign Het
Sptan1 T C 2: 30,007,549 L1228P possibly damaging Het
Stk31 C T 6: 49,421,697 A344V probably benign Het
Supt16 A G 14: 52,170,834 W885R probably damaging Het
Tdrd9 T A 12: 112,025,900 probably null Het
Tmod1 A G 4: 46,078,469 probably null Het
Tnfsf13 A C 11: 69,684,483 probably null Het
Trim75 C A 8: 64,983,442 E119* probably null Het
Wdr6 T C 9: 108,574,911 Y591C probably damaging Het
Wdr86 C T 5: 24,718,283 R137H probably benign Het
Ythdf1 T A 2: 180,911,150 Y424F probably damaging Het
Zfp984 G T 4: 147,756,186 S69R possibly damaging Het
Other mutations in Zyg11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Zyg11a APN 4 108204902 missense probably damaging 0.99
IGL01517:Zyg11a APN 4 108201194 missense probably null 1.00
IGL01619:Zyg11a APN 4 108205217 missense probably damaging 1.00
IGL02253:Zyg11a APN 4 108183695 missense probably null 0.99
R0090:Zyg11a UTSW 4 108201347 splice site probably benign
R0225:Zyg11a UTSW 4 108204641 missense probably damaging 1.00
R0610:Zyg11a UTSW 4 108204857 missense probably damaging 1.00
R0827:Zyg11a UTSW 4 108210042 splice site probably benign
R1568:Zyg11a UTSW 4 108183646 critical splice donor site probably null
R1752:Zyg11a UTSW 4 108205282 missense possibly damaging 0.81
R2051:Zyg11a UTSW 4 108192047 splice site probably benign
R2358:Zyg11a UTSW 4 108196146 missense possibly damaging 0.94
R3898:Zyg11a UTSW 4 108210194 missense probably damaging 0.99
R4288:Zyg11a UTSW 4 108184469 missense probably damaging 1.00
R4381:Zyg11a UTSW 4 108201320 missense possibly damaging 0.58
R4709:Zyg11a UTSW 4 108205071 missense probably benign 0.00
R4859:Zyg11a UTSW 4 108210190 missense probably damaging 0.98
R5303:Zyg11a UTSW 4 108184432 critical splice donor site probably null
R5349:Zyg11a UTSW 4 108183732 missense probably damaging 1.00
R5363:Zyg11a UTSW 4 108189622 missense probably damaging 1.00
R5517:Zyg11a UTSW 4 108204746 missense possibly damaging 0.94
R6175:Zyg11a UTSW 4 108189681 missense probably benign 0.01
R6678:Zyg11a UTSW 4 108189681 missense probably benign 0.01
R7524:Zyg11a UTSW 4 108192074 missense probably damaging 1.00
X0061:Zyg11a UTSW 4 108193993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCACAGAGAAAAGTAACCAGTC -3'
(R):5'- TGCCACGAACACTTCAGTC -3'

Sequencing Primer
(F):5'- CACAGAGAAAAGTAACCAGTCAATTG -3'
(R):5'- ACGAACACTTCAGTCTTTCATGTG -3'
Posted On2018-02-28