Incidental Mutation 'R6254:Noa1'
ID505969
Institutional Source Beutler Lab
Gene Symbol Noa1
Ensembl Gene ENSMUSG00000036285
Gene Namenitric oxide associated 1
Synonyms2610024G14Rik, mAtNOS1
MMRRC Submission 044371-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6254 (G1)
Quality Score111.008
Status Validated
Chromosome5
Chromosomal Location77294182-77310084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77309669 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 130 (F130I)
Ref Sequence ENSEMBL: ENSMUSP00000045948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031167] [ENSMUST00000047860]
Predicted Effect probably benign
Transcript: ENSMUST00000031167
SMART Domains Protein: ENSMUSP00000031167
Gene: ENSMUSG00000029250

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:RNA_pol_Rpb2_1 38 442 2.5e-69 PFAM
Pfam:RNA_pol_Rpb2_2 201 394 3.7e-57 PFAM
Pfam:RNA_pol_Rpb2_3 468 532 6.1e-25 PFAM
Pfam:RNA_pol_Rpb2_4 567 629 7.4e-27 PFAM
Pfam:RNA_pol_Rpb2_5 653 700 1.6e-22 PFAM
Pfam:RNA_pol_Rpb2_6 707 1080 4.5e-129 PFAM
Pfam:RNA_pol_Rpb2_7 1082 1174 3.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047860
AA Change: F130I

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000045948
Gene: ENSMUSG00000036285
AA Change: F130I

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
coiled coil region 83 125 N/A INTRINSIC
low complexity region 224 238 N/A INTRINSIC
Pfam:MMR_HSR1 342 526 6.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150722
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.4%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear-encoded GTPase that functions in the mitochondrion. Upon translation, this protein is imported into the nucleus and then into the nucleolus before being exported to the mitochondrion. The encoded protein is required for oxygen-dependent regulation of mitochondrial respiratory complexes and for mitochondrial protein synthesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogenesis associated with developmental retardation, decreased cell proliferation and apoptosis, increased cell necrosis, and abnormal mitochondrial morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik A G 8: 13,706,043 D26G possibly damaging Het
Adam6b A T 12: 113,489,570 L2F probably damaging Het
Ank2 T A 3: 126,941,804 probably benign Het
Anpep T G 7: 79,839,233 D369A probably damaging Het
App T C 16: 84,978,177 E599G probably damaging Het
Asphd1 C T 7: 126,948,868 V88I probably benign Het
Atad5 A T 11: 80,127,389 I1389F probably damaging Het
Blm T C 7: 80,480,342 N950S probably benign Het
Bsn A T 9: 108,111,866 M2229K probably damaging Het
Cacna2d2 A G 9: 107,509,216 M181V probably benign Het
Cadps2 T A 6: 23,329,163 probably null Het
Cdh1 T A 8: 106,663,798 V590D probably damaging Het
Cdk5rap2 G A 4: 70,364,032 T160M probably damaging Het
Chrna5 A G 9: 55,006,456 M325V probably benign Het
Clca3a2 A G 3: 144,802,134 I116T probably benign Het
Cyp2c23 T C 19: 44,005,463 K488R probably benign Het
Edil3 T A 13: 89,319,729 I451N probably damaging Het
Exph5 T G 9: 53,372,710 S364A possibly damaging Het
Fam84b A G 15: 60,823,801 I32T probably damaging Het
Fam98c A G 7: 29,154,517 S209P probably damaging Het
Fat3 G A 9: 15,996,145 L2854F probably benign Het
Fbxo38 T C 18: 62,505,500 probably null Het
Fermt2 T C 14: 45,476,059 D205G probably damaging Het
Fmnl1 G A 11: 103,196,315 probably benign Het
Fn3k A G 11: 121,435,068 E27G probably damaging Het
Foxj2 A G 6: 122,838,139 H378R probably damaging Het
Fubp1 A G 3: 152,232,408 K140E possibly damaging Het
Gm4788 A G 1: 139,754,390 I156T probably damaging Het
Gm7694 A T 1: 170,302,534 C98* probably null Het
Golgb1 T C 16: 36,913,978 S1196P probably damaging Het
Gpm6a G A 8: 55,047,396 probably null Het
Hltf T A 3: 20,063,829 N80K possibly damaging Het
Il1rap G A 16: 26,695,270 R251H probably benign Het
Ipo7 T A 7: 110,049,060 D688E probably benign Het
Itgal T A 7: 127,325,203 N897K probably damaging Het
Itsn2 A G 12: 4,624,982 probably null Het
Kcnk13 A G 12: 99,965,372 probably benign Het
Kdm7a A G 6: 39,170,269 L248P probably damaging Het
Kmt2c T C 5: 25,349,874 E1254G possibly damaging Het
Ldah G A 12: 8,275,912 probably benign Het
Lingo1 T A 9: 56,620,087 D406V possibly damaging Het
Lrriq1 A T 10: 103,215,451 V480E probably benign Het
Mtcl1 C T 17: 66,358,134 R1142H probably benign Het
Mtmr3 G A 11: 4,497,381 Q360* probably null Het
Muc6 T C 7: 141,651,115 N252S probably benign Het
Naa20 T C 2: 145,903,320 L4P probably damaging Het
Neb T A 2: 52,222,961 I4274L probably benign Het
Nrg4 G T 9: 55,236,512 H87N possibly damaging Het
Olfr1024 T A 2: 85,904,505 Y183F probably damaging Het
Olfr632 T A 7: 103,937,534 H51Q probably benign Het
P3h3 C T 6: 124,845,601 E536K probably damaging Het
Pcdhb11 T C 18: 37,421,718 S34P probably damaging Het
Pik3r1 T C 13: 101,689,406 T71A possibly damaging Het
Plaur T A 7: 24,466,800 C99S possibly damaging Het
Plekha5 G A 6: 140,586,436 G501E probably damaging Het
Plxnd1 C T 6: 115,977,960 V614M probably benign Het
Ppp2r3a T C 9: 101,148,587 D307G possibly damaging Het
Prl3d3 C T 13: 27,157,470 S28F possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Ptk7 C A 17: 46,572,642 Q832H probably damaging Het
Qser1 T C 2: 104,790,090 S126G probably benign Het
Rab3ip A T 10: 116,915,867 C332S probably damaging Het
Raly C A 2: 154,857,366 T30K probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rps6ka1 C T 4: 133,867,224 M159I possibly damaging Het
Rufy3 C T 5: 88,584,309 T57I probably benign Het
Samd4 A G 14: 47,016,631 D184G probably damaging Het
Slc35f3 T C 8: 126,321,094 C58R possibly damaging Het
Smarca4 T C 9: 21,699,877 I1467T probably damaging Het
Spag17 T G 3: 100,065,585 I1371S probably benign Het
Sptan1 T C 2: 30,007,549 L1228P possibly damaging Het
Stk31 C T 6: 49,421,697 A344V probably benign Het
Supt16 A G 14: 52,170,834 W885R probably damaging Het
Tdrd9 T A 12: 112,025,900 probably null Het
Tmod1 A G 4: 46,078,469 probably null Het
Tnfsf13 A C 11: 69,684,483 probably null Het
Trim75 C A 8: 64,983,442 E119* probably null Het
Wdr6 T C 9: 108,574,911 Y591C probably damaging Het
Wdr86 C T 5: 24,718,283 R137H probably benign Het
Ythdf1 T A 2: 180,911,150 Y424F probably damaging Het
Zfp984 G T 4: 147,756,186 S69R possibly damaging Het
Zyg11a A G 4: 108,181,794 F743L probably damaging Het
Other mutations in Noa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02119:Noa1 APN 5 77307579 missense probably benign
IGL02850:Noa1 APN 5 77294491 missense probably benign 0.14
R0149:Noa1 UTSW 5 77297173 nonsense probably null
R0361:Noa1 UTSW 5 77297173 nonsense probably null
R0645:Noa1 UTSW 5 77309875 missense probably benign 0.00
R1226:Noa1 UTSW 5 77307555 missense possibly damaging 0.82
R1710:Noa1 UTSW 5 77309725 missense possibly damaging 0.49
R1721:Noa1 UTSW 5 77307581 missense probably benign 0.00
R1732:Noa1 UTSW 5 77306374 missense probably benign 0.01
R2061:Noa1 UTSW 5 77304187 missense possibly damaging 0.64
R2262:Noa1 UTSW 5 77309804 nonsense probably null
R2965:Noa1 UTSW 5 77306344 missense possibly damaging 0.79
R2966:Noa1 UTSW 5 77306344 missense possibly damaging 0.79
R4405:Noa1 UTSW 5 77306372 missense probably benign 0.00
R4664:Noa1 UTSW 5 77299753 missense probably benign 0.31
R4849:Noa1 UTSW 5 77306332 missense possibly damaging 0.61
R4920:Noa1 UTSW 5 77306487 splice site probably null
R5005:Noa1 UTSW 5 77309026 missense probably damaging 1.00
R5325:Noa1 UTSW 5 77304195 missense probably damaging 1.00
R6112:Noa1 UTSW 5 77309746 missense probably benign 0.01
R7659:Noa1 UTSW 5 77309390 missense not run
R7810:Noa1 UTSW 5 77309224 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGTACTGATCGCGGCTTAC -3'
(R):5'- GCTTTCTGTTCCCGGAGTAC -3'

Sequencing Primer
(F):5'- TGATCGCGGCTTACCTGCAG -3'
(R):5'- TGTTCCCGGAGTACGTCCC -3'
Posted On2018-02-28