Incidental Mutation 'R6254:P3h3'
ID505976
Institutional Source Beutler Lab
Gene Symbol P3h3
Ensembl Gene ENSMUSG00000023191
Gene Nameprolyl 3-hydroxylase 3
SynonymsGrcb, Leprel2
MMRRC Submission 044371-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6254 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location124841089-124857752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 124845601 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 536 (E536K)
Ref Sequence ENSEMBL: ENSMUSP00000023958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023958] [ENSMUST00000135127]
Predicted Effect probably damaging
Transcript: ENSMUST00000023958
AA Change: E536K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023958
Gene: ENSMUSG00000023191
AA Change: E536K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
P4Hc 460 670 8.51e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129225
Predicted Effect probably benign
Transcript: ENSMUST00000135127
SMART Domains Protein: ENSMUSP00000116338
Gene: ENSMUSG00000023191

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149870
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.4%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the leprecan family of proteoglycans, which function as collagen prolyl hydroxylases that are required for proper collagen biosynthesis, folding and assembly. This protein, like other family members, is thought to reside in the endoplasmic reticulum. Epigenetic inactivation of this gene is associated with breast and other cancers, suggesting that it may function as a tumor suppressor. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit collagen fiber fragility in the skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik A G 8: 13,706,043 D26G possibly damaging Het
Adam6b A T 12: 113,489,570 L2F probably damaging Het
Ank2 T A 3: 126,941,804 probably benign Het
Anpep T G 7: 79,839,233 D369A probably damaging Het
App T C 16: 84,978,177 E599G probably damaging Het
Asphd1 C T 7: 126,948,868 V88I probably benign Het
Atad5 A T 11: 80,127,389 I1389F probably damaging Het
Blm T C 7: 80,480,342 N950S probably benign Het
Bsn A T 9: 108,111,866 M2229K probably damaging Het
Cacna2d2 A G 9: 107,509,216 M181V probably benign Het
Cadps2 T A 6: 23,329,163 probably null Het
Cdh1 T A 8: 106,663,798 V590D probably damaging Het
Cdk5rap2 G A 4: 70,364,032 T160M probably damaging Het
Chrna5 A G 9: 55,006,456 M325V probably benign Het
Clca3a2 A G 3: 144,802,134 I116T probably benign Het
Cyp2c23 T C 19: 44,005,463 K488R probably benign Het
Edil3 T A 13: 89,319,729 I451N probably damaging Het
Exph5 T G 9: 53,372,710 S364A possibly damaging Het
Fam84b A G 15: 60,823,801 I32T probably damaging Het
Fam98c A G 7: 29,154,517 S209P probably damaging Het
Fat3 G A 9: 15,996,145 L2854F probably benign Het
Fbxo38 T C 18: 62,505,500 probably null Het
Fermt2 T C 14: 45,476,059 D205G probably damaging Het
Fmnl1 G A 11: 103,196,315 probably benign Het
Fn3k A G 11: 121,435,068 E27G probably damaging Het
Foxj2 A G 6: 122,838,139 H378R probably damaging Het
Fubp1 A G 3: 152,232,408 K140E possibly damaging Het
Gm4788 A G 1: 139,754,390 I156T probably damaging Het
Gm7694 A T 1: 170,302,534 C98* probably null Het
Golgb1 T C 16: 36,913,978 S1196P probably damaging Het
Gpm6a G A 8: 55,047,396 probably null Het
Hltf T A 3: 20,063,829 N80K possibly damaging Het
Il1rap G A 16: 26,695,270 R251H probably benign Het
Ipo7 T A 7: 110,049,060 D688E probably benign Het
Itgal T A 7: 127,325,203 N897K probably damaging Het
Itsn2 A G 12: 4,624,982 probably null Het
Kcnk13 A G 12: 99,965,372 probably benign Het
Kdm7a A G 6: 39,170,269 L248P probably damaging Het
Kmt2c T C 5: 25,349,874 E1254G possibly damaging Het
Ldah G A 12: 8,275,912 probably benign Het
Lingo1 T A 9: 56,620,087 D406V possibly damaging Het
Lrriq1 A T 10: 103,215,451 V480E probably benign Het
Mtcl1 C T 17: 66,358,134 R1142H probably benign Het
Mtmr3 G A 11: 4,497,381 Q360* probably null Het
Muc6 T C 7: 141,651,115 N252S probably benign Het
Naa20 T C 2: 145,903,320 L4P probably damaging Het
Neb T A 2: 52,222,961 I4274L probably benign Het
Noa1 A T 5: 77,309,669 F130I probably benign Het
Nrg4 G T 9: 55,236,512 H87N possibly damaging Het
Olfr1024 T A 2: 85,904,505 Y183F probably damaging Het
Olfr632 T A 7: 103,937,534 H51Q probably benign Het
Pcdhb11 T C 18: 37,421,718 S34P probably damaging Het
Pik3r1 T C 13: 101,689,406 T71A possibly damaging Het
Plaur T A 7: 24,466,800 C99S possibly damaging Het
Plekha5 G A 6: 140,586,436 G501E probably damaging Het
Plxnd1 C T 6: 115,977,960 V614M probably benign Het
Ppp2r3a T C 9: 101,148,587 D307G possibly damaging Het
Prl3d3 C T 13: 27,157,470 S28F possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Ptk7 C A 17: 46,572,642 Q832H probably damaging Het
Qser1 T C 2: 104,790,090 S126G probably benign Het
Rab3ip A T 10: 116,915,867 C332S probably damaging Het
Raly C A 2: 154,857,366 T30K probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rps6ka1 C T 4: 133,867,224 M159I possibly damaging Het
Rufy3 C T 5: 88,584,309 T57I probably benign Het
Samd4 A G 14: 47,016,631 D184G probably damaging Het
Slc35f3 T C 8: 126,321,094 C58R possibly damaging Het
Smarca4 T C 9: 21,699,877 I1467T probably damaging Het
Spag17 T G 3: 100,065,585 I1371S probably benign Het
Sptan1 T C 2: 30,007,549 L1228P possibly damaging Het
Stk31 C T 6: 49,421,697 A344V probably benign Het
Supt16 A G 14: 52,170,834 W885R probably damaging Het
Tdrd9 T A 12: 112,025,900 probably null Het
Tmod1 A G 4: 46,078,469 probably null Het
Tnfsf13 A C 11: 69,684,483 probably null Het
Trim75 C A 8: 64,983,442 E119* probably null Het
Wdr6 T C 9: 108,574,911 Y591C probably damaging Het
Wdr86 C T 5: 24,718,283 R137H probably benign Het
Ythdf1 T A 2: 180,911,150 Y424F probably damaging Het
Zfp984 G T 4: 147,756,186 S69R possibly damaging Het
Zyg11a A G 4: 108,181,794 F743L probably damaging Het
Other mutations in P3h3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:P3h3 APN 6 124845589 missense probably benign 0.26
IGL02158:P3h3 APN 6 124853092 missense probably damaging 1.00
IGL02654:P3h3 APN 6 124845265 missense possibly damaging 0.95
P0040:P3h3 UTSW 6 124853136 missense probably damaging 0.99
R0024:P3h3 UTSW 6 124857458 missense probably benign
R0196:P3h3 UTSW 6 124845272 missense probably damaging 1.00
R0328:P3h3 UTSW 6 124854306 unclassified probably benign
R0589:P3h3 UTSW 6 124841681 missense probably damaging 1.00
R0605:P3h3 UTSW 6 124856035 missense probably damaging 1.00
R0793:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0794:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0795:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0796:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0853:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0854:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0856:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0893:P3h3 UTSW 6 124845513 missense probably damaging 1.00
R1819:P3h3 UTSW 6 124854932 missense probably benign 0.05
R2100:P3h3 UTSW 6 124845042 missense probably damaging 1.00
R4332:P3h3 UTSW 6 124842136 missense probably damaging 1.00
R4461:P3h3 UTSW 6 124845568 missense probably benign 0.08
R4533:P3h3 UTSW 6 124854408 missense possibly damaging 0.62
R4829:P3h3 UTSW 6 124841638 utr 3 prime probably benign
R4840:P3h3 UTSW 6 124850637 missense possibly damaging 0.82
R4962:P3h3 UTSW 6 124841773 missense probably benign 0.09
R5014:P3h3 UTSW 6 124855236 missense probably damaging 1.00
R5591:P3h3 UTSW 6 124854695 unclassified probably benign
R5691:P3h3 UTSW 6 124855153 missense probably damaging 1.00
R5777:P3h3 UTSW 6 124855958 missense probably benign 0.24
R5846:P3h3 UTSW 6 124857194 critical splice donor site probably null
R6212:P3h3 UTSW 6 124845643 missense probably benign 0.19
R6320:P3h3 UTSW 6 124854872 missense probably benign 0.02
R6860:P3h3 UTSW 6 124857368 missense probably benign 0.01
R7385:P3h3 UTSW 6 124855270 missense probably damaging 1.00
R7472:P3h3 UTSW 6 124850631 missense possibly damaging 0.92
R7617:P3h3 UTSW 6 124856006 missense probably damaging 1.00
R7763:P3h3 UTSW 6 124854432 missense probably benign 0.00
X0021:P3h3 UTSW 6 124856029 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGGGGTGACAAATAAGCAG -3'
(R):5'- ACATATTCTGAGACTTGGGATCC -3'

Sequencing Primer
(F):5'- TAAGCAGAGATGCTCCCTGCTC -3'
(R):5'- ATCCTGGTGTCATGGAGTCGC -3'
Posted On2018-02-28