Incidental Mutation 'R6254:Plekha5'
ID505977
Institutional Source Beutler Lab
Gene Symbol Plekha5
Ensembl Gene ENSMUSG00000030231
Gene Namepleckstrin homology domain containing, family A member 5
SynonymsPEPP2, Tg(AMH-cre)1Flor, Gt(Ayu21)9Imeg, AMH-Cre, 2810431N21Rik, Ayu21-9
MMRRC Submission 044371-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R6254 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location140424054-140597110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 140586436 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 501 (G501E)
Ref Sequence ENSEMBL: ENSMUSP00000144973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087622] [ENSMUST00000203012] [ENSMUST00000203483] [ENSMUST00000203517] [ENSMUST00000204080] [ENSMUST00000204145] [ENSMUST00000205026] [ENSMUST00000213444]
Predicted Effect probably damaging
Transcript: ENSMUST00000087622
AA Change: G1088E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084904
Gene: ENSMUSG00000030231
AA Change: G1088E

DomainStartEndE-ValueType
WW 12 44 1.51e-3 SMART
WW 58 90 2.17e-4 SMART
PH 171 271 1.85e-17 SMART
Blast:PH 592 715 7e-39 BLAST
coiled coil region 747 781 N/A INTRINSIC
low complexity region 896 916 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
low complexity region 1206 1224 N/A INTRINSIC
low complexity region 1243 1258 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203012
AA Change: G609E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145499
Gene: ENSMUSG00000030231
AA Change: G609E

DomainStartEndE-ValueType
Blast:PH 210 250 2e-8 BLAST
coiled coil region 268 302 N/A INTRINSIC
low complexity region 417 437 N/A INTRINSIC
low complexity region 445 459 N/A INTRINSIC
low complexity region 727 745 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203483
AA Change: G143E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000145219
Gene: ENSMUSG00000030231
AA Change: G143E

DomainStartEndE-ValueType
low complexity region 261 279 N/A INTRINSIC
low complexity region 298 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203517
AA Change: G980E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000145478
Gene: ENSMUSG00000030231
AA Change: G980E

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
PH 171 271 8.6e-20 SMART
Blast:PH 586 697 3e-15 BLAST
coiled coil region 702 736 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000203955
AA Change: G935E
Predicted Effect probably damaging
Transcript: ENSMUST00000204080
AA Change: G556E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144872
Gene: ENSMUSG00000030231
AA Change: G556E

DomainStartEndE-ValueType
Blast:PH 220 260 1e-8 BLAST
coiled coil region 278 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204145
SMART Domains Protein: ENSMUSP00000145457
Gene: ENSMUSG00000030231

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
Blast:PH 114 151 6e-14 BLAST
PDB:2DKP|A 163 196 1e-5 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204528
Predicted Effect probably damaging
Transcript: ENSMUST00000205026
AA Change: G501E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144973
Gene: ENSMUSG00000030231
AA Change: G501E

DomainStartEndE-ValueType
Blast:PH 165 205 1e-8 BLAST
coiled coil region 223 257 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205255
Predicted Effect probably damaging
Transcript: ENSMUST00000213444
AA Change: G415E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.0818 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.4%
Validation Efficiency 100% (82/82)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik A G 8: 13,706,043 D26G possibly damaging Het
Adam6b A T 12: 113,489,570 L2F probably damaging Het
Ank2 T A 3: 126,941,804 probably benign Het
Anpep T G 7: 79,839,233 D369A probably damaging Het
App T C 16: 84,978,177 E599G probably damaging Het
Asphd1 C T 7: 126,948,868 V88I probably benign Het
Atad5 A T 11: 80,127,389 I1389F probably damaging Het
Blm T C 7: 80,480,342 N950S probably benign Het
Bsn A T 9: 108,111,866 M2229K probably damaging Het
Cacna2d2 A G 9: 107,509,216 M181V probably benign Het
Cadps2 T A 6: 23,329,163 probably null Het
Cdh1 T A 8: 106,663,798 V590D probably damaging Het
Cdk5rap2 G A 4: 70,364,032 T160M probably damaging Het
Chrna5 A G 9: 55,006,456 M325V probably benign Het
Clca3a2 A G 3: 144,802,134 I116T probably benign Het
Cyp2c23 T C 19: 44,005,463 K488R probably benign Het
Edil3 T A 13: 89,319,729 I451N probably damaging Het
Exph5 T G 9: 53,372,710 S364A possibly damaging Het
Fam84b A G 15: 60,823,801 I32T probably damaging Het
Fam98c A G 7: 29,154,517 S209P probably damaging Het
Fat3 G A 9: 15,996,145 L2854F probably benign Het
Fbxo38 T C 18: 62,505,500 probably null Het
Fermt2 T C 14: 45,476,059 D205G probably damaging Het
Fmnl1 G A 11: 103,196,315 probably benign Het
Fn3k A G 11: 121,435,068 E27G probably damaging Het
Foxj2 A G 6: 122,838,139 H378R probably damaging Het
Fubp1 A G 3: 152,232,408 K140E possibly damaging Het
Gm4788 A G 1: 139,754,390 I156T probably damaging Het
Gm7694 A T 1: 170,302,534 C98* probably null Het
Golgb1 T C 16: 36,913,978 S1196P probably damaging Het
Gpm6a G A 8: 55,047,396 probably null Het
Hltf T A 3: 20,063,829 N80K possibly damaging Het
Il1rap G A 16: 26,695,270 R251H probably benign Het
Ipo7 T A 7: 110,049,060 D688E probably benign Het
Itgal T A 7: 127,325,203 N897K probably damaging Het
Itsn2 A G 12: 4,624,982 probably null Het
Kcnk13 A G 12: 99,965,372 probably benign Het
Kdm7a A G 6: 39,170,269 L248P probably damaging Het
Kmt2c T C 5: 25,349,874 E1254G possibly damaging Het
Ldah G A 12: 8,275,912 probably benign Het
Lingo1 T A 9: 56,620,087 D406V possibly damaging Het
Lrriq1 A T 10: 103,215,451 V480E probably benign Het
Mtcl1 C T 17: 66,358,134 R1142H probably benign Het
Mtmr3 G A 11: 4,497,381 Q360* probably null Het
Muc6 T C 7: 141,651,115 N252S probably benign Het
Naa20 T C 2: 145,903,320 L4P probably damaging Het
Neb T A 2: 52,222,961 I4274L probably benign Het
Noa1 A T 5: 77,309,669 F130I probably benign Het
Nrg4 G T 9: 55,236,512 H87N possibly damaging Het
Olfr1024 T A 2: 85,904,505 Y183F probably damaging Het
Olfr632 T A 7: 103,937,534 H51Q probably benign Het
P3h3 C T 6: 124,845,601 E536K probably damaging Het
Pcdhb11 T C 18: 37,421,718 S34P probably damaging Het
Pik3r1 T C 13: 101,689,406 T71A possibly damaging Het
Plaur T A 7: 24,466,800 C99S possibly damaging Het
Plxnd1 C T 6: 115,977,960 V614M probably benign Het
Ppp2r3a T C 9: 101,148,587 D307G possibly damaging Het
Prl3d3 C T 13: 27,157,470 S28F possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Ptk7 C A 17: 46,572,642 Q832H probably damaging Het
Qser1 T C 2: 104,790,090 S126G probably benign Het
Rab3ip A T 10: 116,915,867 C332S probably damaging Het
Raly C A 2: 154,857,366 T30K probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rps6ka1 C T 4: 133,867,224 M159I possibly damaging Het
Rufy3 C T 5: 88,584,309 T57I probably benign Het
Samd4 A G 14: 47,016,631 D184G probably damaging Het
Slc35f3 T C 8: 126,321,094 C58R possibly damaging Het
Smarca4 T C 9: 21,699,877 I1467T probably damaging Het
Spag17 T G 3: 100,065,585 I1371S probably benign Het
Sptan1 T C 2: 30,007,549 L1228P possibly damaging Het
Stk31 C T 6: 49,421,697 A344V probably benign Het
Supt16 A G 14: 52,170,834 W885R probably damaging Het
Tdrd9 T A 12: 112,025,900 probably null Het
Tmod1 A G 4: 46,078,469 probably null Het
Tnfsf13 A C 11: 69,684,483 probably null Het
Trim75 C A 8: 64,983,442 E119* probably null Het
Wdr6 T C 9: 108,574,911 Y591C probably damaging Het
Wdr86 C T 5: 24,718,283 R137H probably benign Het
Ythdf1 T A 2: 180,911,150 Y424F probably damaging Het
Zfp984 G T 4: 147,756,186 S69R possibly damaging Het
Zyg11a A G 4: 108,181,794 F743L probably damaging Het
Other mutations in Plekha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Plekha5 APN 6 140570096 splice site probably benign
IGL00908:Plekha5 APN 6 140550930 missense probably damaging 1.00
IGL01346:Plekha5 APN 6 140534566 splice site probably benign
IGL01380:Plekha5 APN 6 140570316 splice site probably benign
IGL01406:Plekha5 APN 6 140572950 missense probably damaging 0.99
IGL01408:Plekha5 APN 6 140570316 splice site probably benign
IGL01688:Plekha5 APN 6 140569389 missense probably damaging 0.98
IGL01719:Plekha5 APN 6 140570129 missense probably damaging 1.00
IGL01926:Plekha5 APN 6 140525916 missense probably benign 0.12
IGL01936:Plekha5 APN 6 140524895 missense probably damaging 1.00
IGL02326:Plekha5 APN 6 140583850 nonsense probably null
IGL02544:Plekha5 APN 6 140589728 missense possibly damaging 0.78
IGL02573:Plekha5 APN 6 140582016 missense probably damaging 1.00
IGL02704:Plekha5 APN 6 140543866 missense probably damaging 1.00
IGL02959:Plekha5 APN 6 140544178 missense probably damaging 1.00
Doubletime UTSW 6 140525929 nonsense probably null
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0105:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0107:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0359:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0360:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0362:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0363:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0364:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0365:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0833:Plekha5 UTSW 6 140589634 splice site probably benign
R0835:Plekha5 UTSW 6 140568850 nonsense probably null
R0836:Plekha5 UTSW 6 140589634 splice site probably benign
R0944:Plekha5 UTSW 6 140570196 splice site probably benign
R2015:Plekha5 UTSW 6 140534564 critical splice donor site probably null
R2043:Plekha5 UTSW 6 140552804 splice site probably benign
R2086:Plekha5 UTSW 6 140570318 splice site probably null
R2102:Plekha5 UTSW 6 140572877 missense probably damaging 1.00
R2109:Plekha5 UTSW 6 140424216 missense possibly damaging 0.56
R2135:Plekha5 UTSW 6 140580499 missense possibly damaging 0.66
R2150:Plekha5 UTSW 6 140570403 missense probably damaging 1.00
R2211:Plekha5 UTSW 6 140525861 missense possibly damaging 0.56
R2414:Plekha5 UTSW 6 140550856 missense probably damaging 1.00
R2915:Plekha5 UTSW 6 140589199 missense probably damaging 0.96
R3120:Plekha5 UTSW 6 140591641 missense probably benign 0.00
R3924:Plekha5 UTSW 6 140570379 missense possibly damaging 0.78
R4049:Plekha5 UTSW 6 140583871 missense probably damaging 1.00
R4056:Plekha5 UTSW 6 140589232 missense possibly damaging 0.46
R4077:Plekha5 UTSW 6 140555921 intron probably null
R4320:Plekha5 UTSW 6 140543817 missense possibly damaging 0.68
R4343:Plekha5 UTSW 6 140556054 missense probably damaging 0.99
R4359:Plekha5 UTSW 6 140591688 missense probably benign 0.07
R4377:Plekha5 UTSW 6 140579465 missense probably damaging 1.00
R4480:Plekha5 UTSW 6 140526479 missense probably damaging 1.00
R4533:Plekha5 UTSW 6 140570331 missense probably damaging 1.00
R4623:Plekha5 UTSW 6 140551186 missense probably damaging 0.98
R4672:Plekha5 UTSW 6 140524929 missense probably damaging 0.98
R4871:Plekha5 UTSW 6 140525910 missense probably damaging 1.00
R4903:Plekha5 UTSW 6 140586367 missense probably damaging 1.00
R5121:Plekha5 UTSW 6 140579474 missense probably damaging 1.00
R5156:Plekha5 UTSW 6 140426528 missense probably damaging 1.00
R5376:Plekha5 UTSW 6 140551144 missense probably damaging 1.00
R5445:Plekha5 UTSW 6 140552733 nonsense probably null
R5753:Plekha5 UTSW 6 140537004 critical splice acceptor site probably null
R5836:Plekha5 UTSW 6 140426524 missense probably damaging 1.00
R5972:Plekha5 UTSW 6 140572913 missense possibly damaging 0.78
R6196:Plekha5 UTSW 6 140579453 missense probably benign 0.28
R6501:Plekha5 UTSW 6 140525929 nonsense probably null
R6620:Plekha5 UTSW 6 140572875 missense probably damaging 1.00
R6663:Plekha5 UTSW 6 140577290 missense probably damaging 1.00
R6823:Plekha5 UTSW 6 140525858 missense probably benign 0.16
R6992:Plekha5 UTSW 6 140543908 missense probably damaging 1.00
R7196:Plekha5 UTSW 6 140543922 missense possibly damaging 0.83
R7487:Plekha5 UTSW 6 140570333 missense probably benign 0.25
R7493:Plekha5 UTSW 6 140580435 missense probably benign 0.02
R7557:Plekha5 UTSW 6 140426545 missense probably damaging 0.96
X0027:Plekha5 UTSW 6 140424423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTATGCAAGAACCTCACC -3'
(R):5'- GCTAGTGGCTCTTCTGTCAC -3'

Sequencing Primer
(F):5'- TCACCAAGTGAGGGACTGTGC -3'
(R):5'- GTCACTACCCTGGCTGCC -3'
Posted On2018-02-28