Incidental Mutation 'R6254:Fam98c'
ID505979
Institutional Source Beutler Lab
Gene Symbol Fam98c
Ensembl Gene ENSMUSG00000030590
Gene Namefamily with sequence similarity 98, member C
Synonyms
MMRRC Submission 044371-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6254 (G1)
Quality Score217.009
Status Validated
Chromosome7
Chromosomal Location29152510-29156234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29154517 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 209 (S209P)
Ref Sequence ENSEMBL: ENSMUSP00000131477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032811] [ENSMUST00000048923] [ENSMUST00000094617] [ENSMUST00000123416] [ENSMUST00000134176] [ENSMUST00000159351] [ENSMUST00000159975] [ENSMUST00000160396] [ENSMUST00000161522] [ENSMUST00000164589] [ENSMUST00000203070] [ENSMUST00000203380] [ENSMUST00000204194] [ENSMUST00000204845] [ENSMUST00000205027]
Predicted Effect probably benign
Transcript: ENSMUST00000032811
SMART Domains Protein: ENSMUSP00000032811
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 1e-30 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
C1 541 590 4.12e-12 SMART
low complexity region 600 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048923
SMART Domains Protein: ENSMUSP00000046216
Gene: ENSMUSG00000037239

DomainStartEndE-ValueType
Pfam:WH1 1 110 1.6e-13 PFAM
low complexity region 120 130 N/A INTRINSIC
low complexity region 142 153 N/A INTRINSIC
Pfam:Sprouty 292 400 7.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094617
SMART Domains Protein: ENSMUSP00000092200
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 163 2e-29 BLAST
low complexity region 164 189 N/A INTRINSIC
RasGEF 198 434 2.92e-70 SMART
C1 542 596 1.81e-8 SMART
low complexity region 606 615 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123416
SMART Domains Protein: ENSMUSP00000122992
Gene: ENSMUSG00000030590

DomainStartEndE-ValueType
Pfam:DUF2465 6 125 8.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123545
Predicted Effect probably damaging
Transcript: ENSMUST00000134176
AA Change: S7P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120165
Gene: ENSMUSG00000030590
AA Change: S7P

DomainStartEndE-ValueType
Pfam:DUF2465 1 125 5.9e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138084
Predicted Effect unknown
Transcript: ENSMUST00000144795
AA Change: S179P
SMART Domains Protein: ENSMUSP00000121796
Gene: ENSMUSG00000030590
AA Change: S179P

DomainStartEndE-ValueType
Pfam:DUF2465 5 175 1.7e-30 PFAM
Pfam:DUF2465 172 213 1.3e-14 PFAM
Pfam:DUF2465 211 242 6.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150431
Predicted Effect probably benign
Transcript: ENSMUST00000153251
SMART Domains Protein: ENSMUSP00000117500
Gene: ENSMUSG00000030590

DomainStartEndE-ValueType
Pfam:DUF2465 1 114 1.9e-22 PFAM
Pfam:DUF2465 111 196 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159351
SMART Domains Protein: ENSMUSP00000124183
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 7e-31 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
Blast:RasGEF 449 553 7e-25 BLAST
SCOP:d1ptq__ 541 573 1e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159898
Predicted Effect probably benign
Transcript: ENSMUST00000159975
SMART Domains Protein: ENSMUSP00000125137
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 1e-30 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
C1 541 595 1.81e-8 SMART
low complexity region 605 614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160396
Predicted Effect probably benign
Transcript: ENSMUST00000161522
SMART Domains Protein: ENSMUSP00000123718
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 165 7e-32 BLAST
RasGEF 183 419 2.92e-70 SMART
C1 527 576 4.12e-12 SMART
low complexity region 586 595 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164589
AA Change: S209P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131477
Gene: ENSMUSG00000030590
AA Change: S209P

DomainStartEndE-ValueType
Pfam:DUF2465 8 327 3.8e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184073
Predicted Effect probably benign
Transcript: ENSMUST00000203070
SMART Domains Protein: ENSMUSP00000145352
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 504 1.8e-20 SMART
C1 449 498 2.1e-14 SMART
low complexity region 508 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203380
SMART Domains Protein: ENSMUSP00000144753
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 364 3e-25 SMART
C1 472 521 2.1e-14 SMART
low complexity region 531 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204194
SMART Domains Protein: ENSMUSP00000145259
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 85 336 1e-7 SMART
C1 444 493 2.1e-14 SMART
low complexity region 503 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204845
SMART Domains Protein: ENSMUSP00000144774
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 399 8.7e-49 SMART
C1 507 556 2.1e-14 SMART
low complexity region 566 575 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205027
SMART Domains Protein: ENSMUSP00000145186
Gene: ENSMUSG00000030589

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
C1 352 401 2.1e-14 SMART
low complexity region 411 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205672
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.4%
Validation Efficiency 100% (82/82)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik A G 8: 13,706,043 D26G possibly damaging Het
Adam6b A T 12: 113,489,570 L2F probably damaging Het
Ank2 T A 3: 126,941,804 probably benign Het
Anpep T G 7: 79,839,233 D369A probably damaging Het
App T C 16: 84,978,177 E599G probably damaging Het
Asphd1 C T 7: 126,948,868 V88I probably benign Het
Atad5 A T 11: 80,127,389 I1389F probably damaging Het
Blm T C 7: 80,480,342 N950S probably benign Het
Bsn A T 9: 108,111,866 M2229K probably damaging Het
Cacna2d2 A G 9: 107,509,216 M181V probably benign Het
Cadps2 T A 6: 23,329,163 probably null Het
Cdh1 T A 8: 106,663,798 V590D probably damaging Het
Cdk5rap2 G A 4: 70,364,032 T160M probably damaging Het
Chrna5 A G 9: 55,006,456 M325V probably benign Het
Clca3a2 A G 3: 144,802,134 I116T probably benign Het
Cyp2c23 T C 19: 44,005,463 K488R probably benign Het
Edil3 T A 13: 89,319,729 I451N probably damaging Het
Exph5 T G 9: 53,372,710 S364A possibly damaging Het
Fam84b A G 15: 60,823,801 I32T probably damaging Het
Fat3 G A 9: 15,996,145 L2854F probably benign Het
Fbxo38 T C 18: 62,505,500 probably null Het
Fermt2 T C 14: 45,476,059 D205G probably damaging Het
Fmnl1 G A 11: 103,196,315 probably benign Het
Fn3k A G 11: 121,435,068 E27G probably damaging Het
Foxj2 A G 6: 122,838,139 H378R probably damaging Het
Fubp1 A G 3: 152,232,408 K140E possibly damaging Het
Gm4788 A G 1: 139,754,390 I156T probably damaging Het
Gm7694 A T 1: 170,302,534 C98* probably null Het
Golgb1 T C 16: 36,913,978 S1196P probably damaging Het
Gpm6a G A 8: 55,047,396 probably null Het
Hltf T A 3: 20,063,829 N80K possibly damaging Het
Il1rap G A 16: 26,695,270 R251H probably benign Het
Ipo7 T A 7: 110,049,060 D688E probably benign Het
Itgal T A 7: 127,325,203 N897K probably damaging Het
Itsn2 A G 12: 4,624,982 probably null Het
Kcnk13 A G 12: 99,965,372 probably benign Het
Kdm7a A G 6: 39,170,269 L248P probably damaging Het
Kmt2c T C 5: 25,349,874 E1254G possibly damaging Het
Ldah G A 12: 8,275,912 probably benign Het
Lingo1 T A 9: 56,620,087 D406V possibly damaging Het
Lrriq1 A T 10: 103,215,451 V480E probably benign Het
Mtcl1 C T 17: 66,358,134 R1142H probably benign Het
Mtmr3 G A 11: 4,497,381 Q360* probably null Het
Muc6 T C 7: 141,651,115 N252S probably benign Het
Naa20 T C 2: 145,903,320 L4P probably damaging Het
Neb T A 2: 52,222,961 I4274L probably benign Het
Noa1 A T 5: 77,309,669 F130I probably benign Het
Nrg4 G T 9: 55,236,512 H87N possibly damaging Het
Olfr1024 T A 2: 85,904,505 Y183F probably damaging Het
Olfr632 T A 7: 103,937,534 H51Q probably benign Het
P3h3 C T 6: 124,845,601 E536K probably damaging Het
Pcdhb11 T C 18: 37,421,718 S34P probably damaging Het
Pik3r1 T C 13: 101,689,406 T71A possibly damaging Het
Plaur T A 7: 24,466,800 C99S possibly damaging Het
Plekha5 G A 6: 140,586,436 G501E probably damaging Het
Plxnd1 C T 6: 115,977,960 V614M probably benign Het
Ppp2r3a T C 9: 101,148,587 D307G possibly damaging Het
Prl3d3 C T 13: 27,157,470 S28F possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Ptk7 C A 17: 46,572,642 Q832H probably damaging Het
Qser1 T C 2: 104,790,090 S126G probably benign Het
Rab3ip A T 10: 116,915,867 C332S probably damaging Het
Raly C A 2: 154,857,366 T30K probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rps6ka1 C T 4: 133,867,224 M159I possibly damaging Het
Rufy3 C T 5: 88,584,309 T57I probably benign Het
Samd4 A G 14: 47,016,631 D184G probably damaging Het
Slc35f3 T C 8: 126,321,094 C58R possibly damaging Het
Smarca4 T C 9: 21,699,877 I1467T probably damaging Het
Spag17 T G 3: 100,065,585 I1371S probably benign Het
Sptan1 T C 2: 30,007,549 L1228P possibly damaging Het
Stk31 C T 6: 49,421,697 A344V probably benign Het
Supt16 A G 14: 52,170,834 W885R probably damaging Het
Tdrd9 T A 12: 112,025,900 probably null Het
Tmod1 A G 4: 46,078,469 probably null Het
Tnfsf13 A C 11: 69,684,483 probably null Het
Trim75 C A 8: 64,983,442 E119* probably null Het
Wdr6 T C 9: 108,574,911 Y591C probably damaging Het
Wdr86 C T 5: 24,718,283 R137H probably benign Het
Ythdf1 T A 2: 180,911,150 Y424F probably damaging Het
Zfp984 G T 4: 147,756,186 S69R possibly damaging Het
Zyg11a A G 4: 108,181,794 F743L probably damaging Het
Other mutations in Fam98c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Fam98c APN 7 29152853 unclassified probably benign
IGL02603:Fam98c APN 7 29154448 missense probably damaging 1.00
IGL02638:Fam98c APN 7 29152762 missense probably damaging 1.00
R0147:Fam98c UTSW 7 29152721 nonsense probably null
R1248:Fam98c UTSW 7 29152840 missense probably damaging 1.00
R4627:Fam98c UTSW 7 29155268 missense possibly damaging 0.71
R4628:Fam98c UTSW 7 29155268 missense possibly damaging 0.71
R4629:Fam98c UTSW 7 29155268 missense possibly damaging 0.71
R4688:Fam98c UTSW 7 29155241 missense probably damaging 1.00
R5247:Fam98c UTSW 7 29155701 missense possibly damaging 0.84
R6354:Fam98c UTSW 7 29152847 missense probably damaging 1.00
R6388:Fam98c UTSW 7 29155303 missense probably damaging 0.98
R6433:Fam98c UTSW 7 29156128 critical splice donor site probably null
R7058:Fam98c UTSW 7 29155883 critical splice donor site probably null
R7626:Fam98c UTSW 7 29152823 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAGATTCTAAAGTGGCCTGGG -3'
(R):5'- ACCAGATCTCTGAGCTGCTG -3'

Sequencing Primer
(F):5'- AAGAGTATATATTCTTCGCCCTCGAC -3'
(R):5'- TCTGAGCTGCTGCCGTC -3'
Posted On2018-02-28