Mutagenetix > Incidental Mutation

Incidental Mutation 'R6254:Anpep'

505980

Institutional Source

Beutler Lab

Gene Symbol

Anpep

Ensembl Gene

ENSMUSG00000039062

Gene Name

alanyl (membrane) aminopeptidase

Synonyms

aminopeptidase N, Cd13, Apn

MMRRC Submission

044371-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6254 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79821803-79861059 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 79839233 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 369 (D369A)

Ref Sequence

ENSEMBL: ENSMUSP00000103015 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049004] [ENSMUST00000107392] [ENSMUST00000205502] [ENSMUST00000206235]

AlphaFold

P97449

Predicted Effect

probably damaging
Transcript: ENSMUST00000049004
AA Change: D369A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000035943
Gene: ENSMUSG00000039062
AA Change: D369A

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	44	64	N/A	INTRINSIC
Pfam:Peptidase_M1	75	479	6.3e-142	PFAM
Pfam:Peptidase_MA_2	355	502	1.4e-21	PFAM
Pfam:ERAP1_C	618	944	2.9e-45	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000107392
AA Change: D369A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000103015
Gene: ENSMUSG00000039062
AA Change: D369A

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	44	64	N/A	INTRINSIC
Pfam:Peptidase_M1	75	479	2.5e-139	PFAM
Pfam:ERAP1_C	618	943	2e-73	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149164

Predicted Effect

probably benign
Transcript: ENSMUST00000205502

Predicted Effect

probably benign
Transcript: ENSMUST00000206235

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.4%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminopeptidase N is located in the small-intestinal and renal microvillar membrane, and also in other plasma membranes. In the small intestine aminopeptidase N plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases. Its function in proximal tubular epithelial cells and other cell types is less clear. The large extracellular carboxyterminal domain contains a pentapeptide consensus sequence characteristic of members of the zinc-binding metalloproteinase superfamily. Sequence comparisons with known enzymes of this class showed that CD13 and aminopeptidase N are identical. The latter enzyme was thought to be involved in the metabolism of regulatory peptides by diverse cell types, including small intestinal and renal tubular epithelial cells, macrophages, granulocytes, and synaptic membranes from the CNS. Human aminopeptidase N is a receptor for one strain of human coronavirus that is an important cause of upper respiratory tract infections. Defects in this gene appear to be a cause of various types of leukemia or lymphoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for different knock-out alleles exhibit an increase in CD4+ thymocytes, altered macrophage adhesion, pathological neovascularization and/or altered mammary gland morphology during gestation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932443I19Rik	A	G	8: 13,706,043	D26G	possibly damaging	Het
Adam6b	A	T	12: 113,489,570	L2F	probably damaging	Het
Ank2	T	A	3: 126,941,804		probably benign	Het
App	T	C	16: 84,978,177	E599G	probably damaging	Het
Asphd1	C	T	7: 126,948,868	V88I	probably benign	Het
Atad5	A	T	11: 80,127,389	I1389F	probably damaging	Het
Blm	T	C	7: 80,480,342	N950S	probably benign	Het
Bsn	A	T	9: 108,111,866	M2229K	probably damaging	Het
Cacna2d2	A	G	9: 107,509,216	M181V	probably benign	Het
Cadps2	T	A	6: 23,329,163		probably null	Het
Cdh1	T	A	8: 106,663,798	V590D	probably damaging	Het
Cdk5rap2	G	A	4: 70,364,032	T160M	probably damaging	Het
Chrna5	A	G	9: 55,006,456	M325V	probably benign	Het
Clca3a2	A	G	3: 144,802,134	I116T	probably benign	Het
Cyp2c23	T	C	19: 44,005,463	K488R	probably benign	Het
Edil3	T	A	13: 89,319,729	I451N	probably damaging	Het
Exph5	T	G	9: 53,372,710	S364A	possibly damaging	Het
Fam84b	A	G	15: 60,823,801	I32T	probably damaging	Het
Fam98c	A	G	7: 29,154,517	S209P	probably damaging	Het
Fat3	G	A	9: 15,996,145	L2854F	probably benign	Het
Fbxo38	T	C	18: 62,505,500		probably null	Het
Fermt2	T	C	14: 45,476,059	D205G	probably damaging	Het
Fmnl1	G	A	11: 103,196,315		probably benign	Het
Fn3k	A	G	11: 121,435,068	E27G	probably damaging	Het
Foxj2	A	G	6: 122,838,139	H378R	probably damaging	Het
Fubp1	A	G	3: 152,232,408	K140E	possibly damaging	Het
Gm4788	A	G	1: 139,754,390	I156T	probably damaging	Het
Gm7694	A	T	1: 170,302,534	C98*	probably null	Het
Golgb1	T	C	16: 36,913,978	S1196P	probably damaging	Het
Gpm6a	G	A	8: 55,047,396		probably null	Het
Hltf	T	A	3: 20,063,829	N80K	possibly damaging	Het
Il1rap	G	A	16: 26,695,270	R251H	probably benign	Het
Ipo7	T	A	7: 110,049,060	D688E	probably benign	Het
Itgal	T	A	7: 127,325,203	N897K	probably damaging	Het
Itsn2	A	G	12: 4,624,982		probably null	Het
Kcnk13	A	G	12: 99,965,372		probably benign	Het
Kdm7a	A	G	6: 39,170,269	L248P	probably damaging	Het
Kmt2c	T	C	5: 25,349,874	E1254G	possibly damaging	Het
Ldah	G	A	12: 8,275,912		probably benign	Het
Lingo1	T	A	9: 56,620,087	D406V	possibly damaging	Het
Lrriq1	A	T	10: 103,215,451	V480E	probably benign	Het
Mtcl1	C	T	17: 66,358,134	R1142H	probably benign	Het
Mtmr3	G	A	11: 4,497,381	Q360*	probably null	Het
Muc6	T	C	7: 141,651,115	N252S	probably benign	Het
Naa20	T	C	2: 145,903,320	L4P	probably damaging	Het
Neb	T	A	2: 52,222,961	I4274L	probably benign	Het
Noa1	A	T	5: 77,309,669	F130I	probably benign	Het
Nrg4	G	T	9: 55,236,512	H87N	possibly damaging	Het
Olfr1024	T	A	2: 85,904,505	Y183F	probably damaging	Het
Olfr632	T	A	7: 103,937,534	H51Q	probably benign	Het
P3h3	C	T	6: 124,845,601	E536K	probably damaging	Het
Pcdhb11	T	C	18: 37,421,718	S34P	probably damaging	Het
Pik3r1	T	C	13: 101,689,406	T71A	possibly damaging	Het
Plaur	T	A	7: 24,466,800	C99S	possibly damaging	Het
Plekha5	G	A	6: 140,586,436	G501E	probably damaging	Het
Plxnd1	C	T	6: 115,977,960	V614M	probably benign	Het
Ppp2r3a	T	C	9: 101,148,587	D307G	possibly damaging	Het
Prl3d3	C	T	13: 27,157,470	S28F	possibly damaging	Het
Prpf40a	T	C	2: 53,157,915	M197V	probably benign	Het
Ptk7	C	A	17: 46,572,642	Q832H	probably damaging	Het
Qser1	T	C	2: 104,790,090	S126G	probably benign	Het
Rab3ip	A	T	10: 116,915,867	C332S	probably damaging	Het
Raly	C	A	2: 154,857,366	T30K	probably damaging	Het
Rbp2	G	T	9: 98,490,647	S13I	probably benign	Het
Rps6ka1	C	T	4: 133,867,224	M159I	possibly damaging	Het
Rufy3	C	T	5: 88,584,309	T57I	probably benign	Het
Samd4	A	G	14: 47,016,631	D184G	probably damaging	Het
Slc35f3	T	C	8: 126,321,094	C58R	possibly damaging	Het
Smarca4	T	C	9: 21,699,877	I1467T	probably damaging	Het
Spag17	T	G	3: 100,065,585	I1371S	probably benign	Het
Sptan1	T	C	2: 30,007,549	L1228P	possibly damaging	Het
Stk31	C	T	6: 49,421,697	A344V	probably benign	Het
Supt16	A	G	14: 52,170,834	W885R	probably damaging	Het
Tdrd9	T	A	12: 112,025,900		probably null	Het
Tmod1	A	G	4: 46,078,469		probably null	Het
Tnfsf13	A	C	11: 69,684,483		probably null	Het
Trim75	C	A	8: 64,983,442	E119*	probably null	Het
Wdr6	T	C	9: 108,574,911	Y591C	probably damaging	Het
Wdr86	C	T	5: 24,718,283	R137H	probably benign	Het
Ythdf1	T	A	2: 180,911,150	Y424F	probably damaging	Het
Zfp984	G	T	4: 147,756,186	S69R	possibly damaging	Het
Zyg11a	A	G	4: 108,181,794	F743L	probably damaging	Het

Other mutations in Anpep

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Anpep	APN	7	79825736	missense	possibly damaging	0.64
IGL00089:Anpep	APN	7	79841986	missense	probably damaging	1.00
IGL00767:Anpep	APN	7	79840890	missense	probably benign	0.00
IGL00901:Anpep	APN	7	79839423	missense	probably benign
IGL01919:Anpep	APN	7	79825350	missense	possibly damaging	0.77
IGL02049:Anpep	APN	7	79835181	missense	probably damaging	0.97
IGL02195:Anpep	APN	7	79826685	missense	probably damaging	1.00
IGL02210:Anpep	APN	7	79826904	missense	probably benign	0.00
IGL02584:Anpep	APN	7	79825393	splice site	probably benign
IGL02677:Anpep	APN	7	79838730	missense	probably damaging	1.00
IGL03073:Anpep	APN	7	79838955	missense	probably damaging	1.00
IGL03100:Anpep	APN	7	79836361	missense	probably benign	0.01
PIT4696001:Anpep	UTSW	7	79839464	missense	possibly damaging	0.85
R0329:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R0330:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R0619:Anpep	UTSW	7	79841009	missense	probably benign
R0691:Anpep	UTSW	7	79839299	missense	probably damaging	0.98
R1004:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1005:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1274:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1288:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1289:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1532:Anpep	UTSW	7	79826948	nonsense	probably null
R1540:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1574:Anpep	UTSW	7	79838407	splice site	probably null
R1574:Anpep	UTSW	7	79838407	splice site	probably null
R1618:Anpep	UTSW	7	79835417	missense	probably benign	0.00
R1627:Anpep	UTSW	7	79842011	missense	probably benign
R1693:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1717:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1745:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1746:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1748:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1809:Anpep	UTSW	7	79841823	missense	probably benign	0.01
R1901:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1902:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1903:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1985:Anpep	UTSW	7	79840857	splice site	probably null
R2379:Anpep	UTSW	7	79841218	missense	probably benign	0.28
R2508:Anpep	UTSW	7	79838291	missense	possibly damaging	0.80
R3110:Anpep	UTSW	7	79841972	missense	probably benign	0.15
R3112:Anpep	UTSW	7	79841972	missense	probably benign	0.15
R3898:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R3899:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R3900:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R4211:Anpep	UTSW	7	79840996	nonsense	probably null
R4701:Anpep	UTSW	7	79839465	missense	probably benign	0.16
R4716:Anpep	UTSW	7	79826632	missense	probably benign	0.00
R5020:Anpep	UTSW	7	79833727	missense	probably benign
R5042:Anpep	UTSW	7	79839469	missense	probably benign	0.00
R5084:Anpep	UTSW	7	79826870	critical splice donor site	probably null
R5319:Anpep	UTSW	7	79841731	missense	probably benign
R5593:Anpep	UTSW	7	79842046	missense	probably benign	0.04
R5778:Anpep	UTSW	7	79836391	missense	probably benign	0.00
R5852:Anpep	UTSW	7	79838972	nonsense	probably null
R5906:Anpep	UTSW	7	79833675	missense	probably benign
R6164:Anpep	UTSW	7	79842205	missense	possibly damaging	0.68
R6284:Anpep	UTSW	7	79825802	missense	probably damaging	1.00
R6380:Anpep	UTSW	7	79841896	missense	probably benign	0.04
R6594:Anpep	UTSW	7	79841361	splice site	probably null
R6746:Anpep	UTSW	7	79839185	splice site	probably null
R6920:Anpep	UTSW	7	79825349	missense	probably damaging	1.00
R7060:Anpep	UTSW	7	79841794	missense	probably benign	0.33
R7072:Anpep	UTSW	7	79835379	missense	possibly damaging	0.58
R7095:Anpep	UTSW	7	79842202	missense	possibly damaging	0.87
R7102:Anpep	UTSW	7	79836313	missense	probably benign	0.00
R7178:Anpep	UTSW	7	79840988	missense	probably benign
R7223:Anpep	UTSW	7	79825310	missense	probably damaging	1.00
R7344:Anpep	UTSW	7	79838650	missense	possibly damaging	0.60
R7441:Anpep	UTSW	7	79827644	missense	possibly damaging	0.93
R7479:Anpep	UTSW	7	79835370	missense	probably benign	0.11
R7503:Anpep	UTSW	7	79826637	missense	probably damaging	1.00
R7683:Anpep	UTSW	7	79839198	missense	probably damaging	0.98
R7912:Anpep	UTSW	7	79838426	missense	probably benign	0.00
R7935:Anpep	UTSW	7	79826961	missense	possibly damaging	0.46
R8036:Anpep	UTSW	7	79841898	missense	probably benign	0.11
R8039:Anpep	UTSW	7	79839400	critical splice donor site	probably null
R8470:Anpep	UTSW	7	79839521	missense	probably benign	0.16
R8549:Anpep	UTSW	7	79840896	missense	probably benign	0.00
R8723:Anpep	UTSW	7	79838938	missense	probably damaging	1.00
R8726:Anpep	UTSW	7	79840893	missense	probably benign	0.00
R9042:Anpep	UTSW	7	79838762	missense	probably damaging	0.99
R9151:Anpep	UTSW	7	79842037	missense	probably benign	0.31
R9200:Anpep	UTSW	7	79841122	missense	probably benign	0.00
R9216:Anpep	UTSW	7	79836301	missense	possibly damaging	0.49
R9570:Anpep	UTSW	7	79826913	missense	probably benign	0.00
Z1176:Anpep	UTSW	7	79827639	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- CGTTCAGCCACAGATCATTCC -3'
(R):5'- TAAGTGACCATGGGGCCTAC -3'

Sequencing Primer
(F):5'- CGTTGAGTCTCACAGGCCTTG -3'
(R):5'- CCTACATGGAGGTAGTGCCAG -3'

Posted On

2018-02-28