Incidental Mutation 'R6254:Blm'
ID 505981
Institutional Source Beutler Lab
Gene Symbol Blm
Ensembl Gene ENSMUSG00000030528
Gene Name Bloom syndrome, RecQ like helicase
Synonyms
MMRRC Submission 044371-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6254 (G1)
Quality Score 220.009
Status Validated
Chromosome 7
Chromosomal Location 80454733-80535119 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80480342 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 950 (N950S)
Ref Sequence ENSEMBL: ENSMUSP00000127995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081314] [ENSMUST00000170315]
AlphaFold O88700
Predicted Effect probably benign
Transcript: ENSMUST00000081314
AA Change: N947S

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000080062
Gene: ENSMUSG00000030528
AA Change: N947S

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 219 231 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
Pfam:BDHCT 376 416 5.5e-27 PFAM
low complexity region 557 574 N/A INTRINSIC
DEXDc 672 873 1.59e-29 SMART
HELICc 910 992 1.29e-24 SMART
RQC 1084 1198 1.43e-15 SMART
HRDC 1217 1297 9.4e-20 SMART
low complexity region 1357 1371 N/A INTRINSIC
low complexity region 1378 1392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170315
AA Change: N950S

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000127995
Gene: ENSMUSG00000030528
AA Change: N950S

DomainStartEndE-ValueType
Pfam:BLM_N 4 375 1.1e-161 PFAM
Pfam:BDHCT 380 419 6.4e-25 PFAM
Pfam:BDHCT_assoc 433 658 8.8e-108 PFAM
DEXDc 675 876 1.59e-29 SMART
HELICc 913 995 1.29e-24 SMART
Pfam:RecQ_Zn_bind 1006 1078 1.5e-19 PFAM
RQC 1087 1201 1.43e-15 SMART
HRDC 1220 1300 9.4e-20 SMART
low complexity region 1360 1374 N/A INTRINSIC
low complexity region 1381 1395 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205584
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.4%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are developmentally delayed, with increased apopotosis in the epiblast and severe anemia, dying at embyronic day 13.5; but homozygotes for a cre mediated recombinant allele are viable Bloom syndrome-like mice prone to a wide variety of cancers and showing increased rates of LOH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik A G 8: 13,706,043 D26G possibly damaging Het
Adam6b A T 12: 113,489,570 L2F probably damaging Het
Ank2 T A 3: 126,941,804 probably benign Het
Anpep T G 7: 79,839,233 D369A probably damaging Het
App T C 16: 84,978,177 E599G probably damaging Het
Asphd1 C T 7: 126,948,868 V88I probably benign Het
Atad5 A T 11: 80,127,389 I1389F probably damaging Het
Bsn A T 9: 108,111,866 M2229K probably damaging Het
Cacna2d2 A G 9: 107,509,216 M181V probably benign Het
Cadps2 T A 6: 23,329,163 probably null Het
Cdh1 T A 8: 106,663,798 V590D probably damaging Het
Cdk5rap2 G A 4: 70,364,032 T160M probably damaging Het
Chrna5 A G 9: 55,006,456 M325V probably benign Het
Clca3a2 A G 3: 144,802,134 I116T probably benign Het
Cyp2c23 T C 19: 44,005,463 K488R probably benign Het
Edil3 T A 13: 89,319,729 I451N probably damaging Het
Exph5 T G 9: 53,372,710 S364A possibly damaging Het
Fam84b A G 15: 60,823,801 I32T probably damaging Het
Fam98c A G 7: 29,154,517 S209P probably damaging Het
Fat3 G A 9: 15,996,145 L2854F probably benign Het
Fbxo38 T C 18: 62,505,500 probably null Het
Fermt2 T C 14: 45,476,059 D205G probably damaging Het
Fmnl1 G A 11: 103,196,315 probably benign Het
Fn3k A G 11: 121,435,068 E27G probably damaging Het
Foxj2 A G 6: 122,838,139 H378R probably damaging Het
Fubp1 A G 3: 152,232,408 K140E possibly damaging Het
Gm4788 A G 1: 139,754,390 I156T probably damaging Het
Gm7694 A T 1: 170,302,534 C98* probably null Het
Golgb1 T C 16: 36,913,978 S1196P probably damaging Het
Gpm6a G A 8: 55,047,396 probably null Het
Hltf T A 3: 20,063,829 N80K possibly damaging Het
Il1rap G A 16: 26,695,270 R251H probably benign Het
Ipo7 T A 7: 110,049,060 D688E probably benign Het
Itgal T A 7: 127,325,203 N897K probably damaging Het
Itsn2 A G 12: 4,624,982 probably null Het
Kcnk13 A G 12: 99,965,372 probably benign Het
Kdm7a A G 6: 39,170,269 L248P probably damaging Het
Kmt2c T C 5: 25,349,874 E1254G possibly damaging Het
Ldah G A 12: 8,275,912 probably benign Het
Lingo1 T A 9: 56,620,087 D406V possibly damaging Het
Lrriq1 A T 10: 103,215,451 V480E probably benign Het
Mtcl1 C T 17: 66,358,134 R1142H probably benign Het
Mtmr3 G A 11: 4,497,381 Q360* probably null Het
Muc6 T C 7: 141,651,115 N252S probably benign Het
Naa20 T C 2: 145,903,320 L4P probably damaging Het
Neb T A 2: 52,222,961 I4274L probably benign Het
Noa1 A T 5: 77,309,669 F130I probably benign Het
Nrg4 G T 9: 55,236,512 H87N possibly damaging Het
Olfr1024 T A 2: 85,904,505 Y183F probably damaging Het
Olfr632 T A 7: 103,937,534 H51Q probably benign Het
P3h3 C T 6: 124,845,601 E536K probably damaging Het
Pcdhb11 T C 18: 37,421,718 S34P probably damaging Het
Pik3r1 T C 13: 101,689,406 T71A possibly damaging Het
Plaur T A 7: 24,466,800 C99S possibly damaging Het
Plekha5 G A 6: 140,586,436 G501E probably damaging Het
Plxnd1 C T 6: 115,977,960 V614M probably benign Het
Ppp2r3a T C 9: 101,148,587 D307G possibly damaging Het
Prl3d3 C T 13: 27,157,470 S28F possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Ptk7 C A 17: 46,572,642 Q832H probably damaging Het
Qser1 T C 2: 104,790,090 S126G probably benign Het
Rab3ip A T 10: 116,915,867 C332S probably damaging Het
Raly C A 2: 154,857,366 T30K probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rps6ka1 C T 4: 133,867,224 M159I possibly damaging Het
Rufy3 C T 5: 88,584,309 T57I probably benign Het
Samd4 A G 14: 47,016,631 D184G probably damaging Het
Slc35f3 T C 8: 126,321,094 C58R possibly damaging Het
Smarca4 T C 9: 21,699,877 I1467T probably damaging Het
Spag17 T G 3: 100,065,585 I1371S probably benign Het
Sptan1 T C 2: 30,007,549 L1228P possibly damaging Het
Stk31 C T 6: 49,421,697 A344V probably benign Het
Supt16 A G 14: 52,170,834 W885R probably damaging Het
Tdrd9 T A 12: 112,025,900 probably null Het
Tmod1 A G 4: 46,078,469 probably null Het
Tnfsf13 A C 11: 69,684,483 probably null Het
Trim75 C A 8: 64,983,442 E119* probably null Het
Wdr6 T C 9: 108,574,911 Y591C probably damaging Het
Wdr86 C T 5: 24,718,283 R137H probably benign Het
Ythdf1 T A 2: 180,911,150 Y424F probably damaging Het
Zfp984 G T 4: 147,756,186 S69R possibly damaging Het
Zyg11a A G 4: 108,181,794 F743L probably damaging Het
Other mutations in Blm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Blm APN 7 80474071 missense probably damaging 1.00
IGL01658:Blm APN 7 80463941 missense probably damaging 0.98
IGL02048:Blm APN 7 80502961 splice site probably benign
IGL02060:Blm APN 7 80514580 splice site probably benign
IGL02063:Blm APN 7 80509419 nonsense probably null
IGL02102:Blm APN 7 80469756 missense probably damaging 1.00
IGL02420:Blm APN 7 80496006 missense probably damaging 1.00
IGL02452:Blm APN 7 80503377 splice site probably null
IGL02566:Blm APN 7 80474196 missense probably damaging 1.00
IGL03387:Blm APN 7 80494147 missense probably damaging 1.00
FR4304:Blm UTSW 7 80463773 frame shift probably null
FR4304:Blm UTSW 7 80512919 small insertion probably benign
FR4340:Blm UTSW 7 80463767 unclassified probably benign
FR4340:Blm UTSW 7 80512907 small insertion probably benign
FR4340:Blm UTSW 7 80512910 small insertion probably benign
FR4449:Blm UTSW 7 80512908 small insertion probably benign
FR4548:Blm UTSW 7 80463769 frame shift probably null
FR4589:Blm UTSW 7 80463770 frame shift probably null
FR4737:Blm UTSW 7 80463771 frame shift probably null
FR4737:Blm UTSW 7 80463774 frame shift probably null
FR4976:Blm UTSW 7 80463767 unclassified probably benign
FR4976:Blm UTSW 7 80512907 small insertion probably benign
R0133:Blm UTSW 7 80502367 missense possibly damaging 0.93
R0194:Blm UTSW 7 80464946 unclassified probably benign
R0526:Blm UTSW 7 80505893 nonsense probably null
R0673:Blm UTSW 7 80499751 critical splice donor site probably null
R0972:Blm UTSW 7 80513370 missense probably benign
R0980:Blm UTSW 7 80499958 splice site probably null
R1120:Blm UTSW 7 80481466 missense probably damaging 1.00
R1301:Blm UTSW 7 80455417 nonsense probably null
R1769:Blm UTSW 7 80513370 missense probably benign
R1866:Blm UTSW 7 80494114 missense probably benign 0.08
R1874:Blm UTSW 7 80497418 missense probably damaging 1.00
R1966:Blm UTSW 7 80513186 missense possibly damaging 0.86
R1991:Blm UTSW 7 80505949 splice site probably null
R2013:Blm UTSW 7 80502399 missense probably damaging 0.99
R2014:Blm UTSW 7 80502399 missense probably damaging 0.99
R2015:Blm UTSW 7 80502399 missense probably damaging 0.99
R2016:Blm UTSW 7 80505926 missense probably benign 0.26
R2103:Blm UTSW 7 80505949 splice site probably null
R2161:Blm UTSW 7 80481370 splice site probably null
R2215:Blm UTSW 7 80499847 missense possibly damaging 0.69
R3689:Blm UTSW 7 80513079 missense possibly damaging 0.56
R4049:Blm UTSW 7 80502862 missense probably benign 0.04
R4155:Blm UTSW 7 80512904 small deletion probably benign
R4695:Blm UTSW 7 80494228 missense probably damaging 1.00
R4774:Blm UTSW 7 80463848 missense probably damaging 1.00
R4833:Blm UTSW 7 80466826 missense probably benign
R4835:Blm UTSW 7 80509546 missense probably benign 0.41
R4994:Blm UTSW 7 80458825 missense probably benign 0.00
R5039:Blm UTSW 7 80505873 missense possibly damaging 0.50
R5330:Blm UTSW 7 80458936 missense possibly damaging 0.73
R5375:Blm UTSW 7 80513229 missense probably benign 0.00
R5408:Blm UTSW 7 80502622 missense probably benign 0.01
R5574:Blm UTSW 7 80499773 missense probably damaging 1.00
R5606:Blm UTSW 7 80460832 splice site probably null
R5702:Blm UTSW 7 80458927 missense probably benign 0.13
R5809:Blm UTSW 7 80464844 missense probably damaging 1.00
R6114:Blm UTSW 7 80513487 missense probably damaging 1.00
R6157:Blm UTSW 7 80512985 missense probably benign 0.18
R6163:Blm UTSW 7 80512904 small deletion probably benign
R6266:Blm UTSW 7 80499940 missense probably benign 0.03
R6364:Blm UTSW 7 80494526 nonsense probably null
R6446:Blm UTSW 7 80512904 small deletion probably benign
R6502:Blm UTSW 7 80481475 missense probably damaging 0.98
R6700:Blm UTSW 7 80463850 missense possibly damaging 0.91
R7002:Blm UTSW 7 80469753 missense probably benign 0.00
R7105:Blm UTSW 7 80499768 missense probably benign 0.44
R7320:Blm UTSW 7 80455354 nonsense probably null
R7465:Blm UTSW 7 80513115 missense probably benign 0.02
R7561:Blm UTSW 7 80502528 missense probably damaging 0.99
R8500:Blm UTSW 7 80455284 missense probably damaging 1.00
R8543:Blm UTSW 7 80494216 missense probably damaging 0.98
R8774-TAIL:Blm UTSW 7 80512907 small insertion probably benign
R8774-TAIL:Blm UTSW 7 80512918 small insertion probably benign
R8774-TAIL:Blm UTSW 7 80512919 small insertion probably benign
R8775-TAIL:Blm UTSW 7 80512931 small insertion probably benign
R8860:Blm UTSW 7 80494528 missense probably benign 0.30
R8928:Blm UTSW 7 80512904 small deletion probably benign
R9089:Blm UTSW 7 80513119 missense probably damaging 1.00
R9363:Blm UTSW 7 80458915 missense probably damaging 1.00
RF001:Blm UTSW 7 80512903 small insertion probably benign
RF001:Blm UTSW 7 80512906 small insertion probably benign
RF001:Blm UTSW 7 80512927 small insertion probably benign
RF002:Blm UTSW 7 80512905 small insertion probably benign
RF002:Blm UTSW 7 80512927 small insertion probably benign
RF007:Blm UTSW 7 80512933 nonsense probably null
RF016:Blm UTSW 7 80512926 nonsense probably null
RF018:Blm UTSW 7 80512926 nonsense probably null
RF027:Blm UTSW 7 80512914 frame shift probably null
RF028:Blm UTSW 7 80512905 nonsense probably null
RF031:Blm UTSW 7 80512906 small insertion probably benign
RF031:Blm UTSW 7 80512923 small insertion probably benign
RF032:Blm UTSW 7 80512930 small insertion probably benign
RF036:Blm UTSW 7 80512914 nonsense probably null
RF044:Blm UTSW 7 80512930 small insertion probably benign
RF053:Blm UTSW 7 80512921 small insertion probably benign
RF064:Blm UTSW 7 80512923 nonsense probably null
X0061:Blm UTSW 7 80458850 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCAGCTTACTTGGATGTTTATGACC -3'
(R):5'- GGCTTCTTGGCAGATGACTC -3'

Sequencing Primer
(F):5'- CTCCCGAGTGCTGGGATTAAAG -3'
(R):5'- ACTCGGGGATAATTTACTGCC -3'
Posted On 2018-02-28