Mutagenetix > Incidental Mutations

Incidental Mutation 'R6254:Ipo7'

505983

Institutional Source

Beutler Lab

Gene Symbol

Ipo7

Ensembl Gene

ENSMUSG00000066232

Gene Name

importin 7

Synonyms

A330055O14Rik, Imp7, RanBP7

MMRRC Submission

044371-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.959) question?

Stock #

R6254 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110018274-110056609 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 110049060 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 688 (D688E)

Ref Sequence

ENSEMBL: ENSMUSP00000081782 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084731] [ENSMUST00000208951]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082517

Predicted Effect

probably benign
Transcript: ENSMUST00000084731
AA Change: D688E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000081782
Gene: ENSMUSG00000066232
AA Change: D688E

Domain	Start	End	E-Value	Type
IBN_N	22	101	3.06e-15	SMART
Pfam:Cse1	168	452	2.8e-12	PFAM
low complexity region	701	712	N/A	INTRINSIC
low complexity region	881	900	N/A	INTRINSIC
low complexity region	923	939	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185931

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207277

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208821

Predicted Effect

probably benign
Transcript: ENSMUST00000208951

Meta Mutation Damage Score

0.0641

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.4%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The importin-alpha/beta complex and the GTPase Ran mediate nuclear import of proteins with a classical nuclear localization signal. The protein encoded by this gene is a member of a class of approximately 20 potential Ran targets that share a sequence motif related to the Ran-binding site of importin-beta. Similar to importin-beta, this protein prevents the activation of Ran's GTPase by RanGAP1 and inhibits nucleotide exchange on RanGTP, and also binds directly to nuclear pore complexes where it competes for binding sites with importin-beta and transportin. This protein has a Ran-dependent transport cycle and it can cross the nuclear envelope rapidly and in both directions. At least four importin beta-like transport receptors, namely importin beta itself, transportin, RanBP5 and RanBP7, directly bind and import ribosomal proteins. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932443I19Rik	A	G	8: 13,706,043	D26G	possibly damaging	Het
Adam6b	A	T	12: 113,489,570	L2F	probably damaging	Het
Ank2	T	A	3: 126,941,804		probably benign	Het
Anpep	T	G	7: 79,839,233	D369A	probably damaging	Het
App	T	C	16: 84,978,177	E599G	probably damaging	Het
Asphd1	C	T	7: 126,948,868	V88I	probably benign	Het
Atad5	A	T	11: 80,127,389	I1389F	probably damaging	Het
Blm	T	C	7: 80,480,342	N950S	probably benign	Het
Bsn	A	T	9: 108,111,866	M2229K	probably damaging	Het
Cacna2d2	A	G	9: 107,509,216	M181V	probably benign	Het
Cadps2	T	A	6: 23,329,163		probably null	Het
Cdh1	T	A	8: 106,663,798	V590D	probably damaging	Het
Cdk5rap2	G	A	4: 70,364,032	T160M	probably damaging	Het
Chrna5	A	G	9: 55,006,456	M325V	probably benign	Het
Clca3a2	A	G	3: 144,802,134	I116T	probably benign	Het
Cyp2c23	T	C	19: 44,005,463	K488R	probably benign	Het
Edil3	T	A	13: 89,319,729	I451N	probably damaging	Het
Exph5	T	G	9: 53,372,710	S364A	possibly damaging	Het
Fam84b	A	G	15: 60,823,801	I32T	probably damaging	Het
Fam98c	A	G	7: 29,154,517	S209P	probably damaging	Het
Fat3	G	A	9: 15,996,145	L2854F	probably benign	Het
Fbxo38	T	C	18: 62,505,500		probably null	Het
Fermt2	T	C	14: 45,476,059	D205G	probably damaging	Het
Fmnl1	G	A	11: 103,196,315		probably benign	Het
Fn3k	A	G	11: 121,435,068	E27G	probably damaging	Het
Foxj2	A	G	6: 122,838,139	H378R	probably damaging	Het
Fubp1	A	G	3: 152,232,408	K140E	possibly damaging	Het
Gm4788	A	G	1: 139,754,390	I156T	probably damaging	Het
Gm7694	A	T	1: 170,302,534	C98*	probably null	Het
Golgb1	T	C	16: 36,913,978	S1196P	probably damaging	Het
Gpm6a	G	A	8: 55,047,396		probably null	Het
Hltf	T	A	3: 20,063,829	N80K	possibly damaging	Het
Il1rap	G	A	16: 26,695,270	R251H	probably benign	Het
Itgal	T	A	7: 127,325,203	N897K	probably damaging	Het
Itsn2	A	G	12: 4,624,982		probably null	Het
Kcnk13	A	G	12: 99,965,372		probably benign	Het
Kdm7a	A	G	6: 39,170,269	L248P	probably damaging	Het
Kmt2c	T	C	5: 25,349,874	E1254G	possibly damaging	Het
Ldah	G	A	12: 8,275,912		probably benign	Het
Lingo1	T	A	9: 56,620,087	D406V	possibly damaging	Het
Lrriq1	A	T	10: 103,215,451	V480E	probably benign	Het
Mtcl1	C	T	17: 66,358,134	R1142H	probably benign	Het
Mtmr3	G	A	11: 4,497,381	Q360*	probably null	Het
Muc6	T	C	7: 141,651,115	N252S	probably benign	Het
Naa20	T	C	2: 145,903,320	L4P	probably damaging	Het
Neb	T	A	2: 52,222,961	I4274L	probably benign	Het
Noa1	A	T	5: 77,309,669	F130I	probably benign	Het
Nrg4	G	T	9: 55,236,512	H87N	possibly damaging	Het
Olfr1024	T	A	2: 85,904,505	Y183F	probably damaging	Het
Olfr632	T	A	7: 103,937,534	H51Q	probably benign	Het
P3h3	C	T	6: 124,845,601	E536K	probably damaging	Het
Pcdhb11	T	C	18: 37,421,718	S34P	probably damaging	Het
Pik3r1	T	C	13: 101,689,406	T71A	possibly damaging	Het
Plaur	T	A	7: 24,466,800	C99S	possibly damaging	Het
Plekha5	G	A	6: 140,586,436	G501E	probably damaging	Het
Plxnd1	C	T	6: 115,977,960	V614M	probably benign	Het
Ppp2r3a	T	C	9: 101,148,587	D307G	possibly damaging	Het
Prl3d3	C	T	13: 27,157,470	S28F	possibly damaging	Het
Prpf40a	T	C	2: 53,157,915	M197V	probably benign	Het
Ptk7	C	A	17: 46,572,642	Q832H	probably damaging	Het
Qser1	T	C	2: 104,790,090	S126G	probably benign	Het
Rab3ip	A	T	10: 116,915,867	C332S	probably damaging	Het
Raly	C	A	2: 154,857,366	T30K	probably damaging	Het
Rbp2	G	T	9: 98,490,647	S13I	probably benign	Het
Rps6ka1	C	T	4: 133,867,224	M159I	possibly damaging	Het
Rufy3	C	T	5: 88,584,309	T57I	probably benign	Het
Samd4	A	G	14: 47,016,631	D184G	probably damaging	Het
Slc35f3	T	C	8: 126,321,094	C58R	possibly damaging	Het
Smarca4	T	C	9: 21,699,877	I1467T	probably damaging	Het
Spag17	T	G	3: 100,065,585	I1371S	probably benign	Het
Sptan1	T	C	2: 30,007,549	L1228P	possibly damaging	Het
Stk31	C	T	6: 49,421,697	A344V	probably benign	Het
Supt16	A	G	14: 52,170,834	W885R	probably damaging	Het
Tdrd9	T	A	12: 112,025,900		probably null	Het
Tmod1	A	G	4: 46,078,469		probably null	Het
Tnfsf13	A	C	11: 69,684,483		probably null	Het
Trim75	C	A	8: 64,983,442	E119*	probably null	Het
Wdr6	T	C	9: 108,574,911	Y591C	probably damaging	Het
Wdr86	C	T	5: 24,718,283	R137H	probably benign	Het
Ythdf1	T	A	2: 180,911,150	Y424F	probably damaging	Het
Zfp984	G	T	4: 147,756,186	S69R	possibly damaging	Het
Zyg11a	A	G	4: 108,181,794	F743L	probably damaging	Het

Other mutations in Ipo7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01796:Ipo7	APN	7	110029848	intron	probably benign
IGL02472:Ipo7	APN	7	110040853	missense	probably damaging	1.00
IGL02502:Ipo7	APN	7	110051050	missense	probably damaging	1.00
IGL02514:Ipo7	APN	7	110048828	missense	possibly damaging	0.78
IGL02535:Ipo7	APN	7	110054026	missense	probably damaging	0.98
IGL02961:Ipo7	APN	7	110047016	missense	probably benign	0.02
R0089:Ipo7	UTSW	7	110050765	intron	probably benign
R0355:Ipo7	UTSW	7	110049661	missense	probably benign	0.00
R0565:Ipo7	UTSW	7	110049593	intron	probably benign
R1342:Ipo7	UTSW	7	110029804	missense	possibly damaging	0.82
R1405:Ipo7	UTSW	7	110029841	missense	probably benign	0.03
R1405:Ipo7	UTSW	7	110039249	missense	probably damaging	0.97
R1405:Ipo7	UTSW	7	110029841	missense	probably benign	0.03
R1405:Ipo7	UTSW	7	110039249	missense	probably damaging	0.97
R1791:Ipo7	UTSW	7	110027132	missense	probably damaging	0.98
R1838:Ipo7	UTSW	7	110042109	missense	probably damaging	1.00
R2116:Ipo7	UTSW	7	110051118	missense	probably damaging	0.99
R2120:Ipo7	UTSW	7	110049631	missense	probably damaging	1.00
R4366:Ipo7	UTSW	7	110029712	missense	possibly damaging	0.58
R4366:Ipo7	UTSW	7	110048216	missense	possibly damaging	0.88
R4805:Ipo7	UTSW	7	110051484	missense	probably benign	0.16
R5228:Ipo7	UTSW	7	110046762	missense	probably benign	0.00
R5903:Ipo7	UTSW	7	110050813	missense	probably damaging	1.00
R5976:Ipo7	UTSW	7	110048807	missense	probably damaging	1.00
R6335:Ipo7	UTSW	7	110018468	missense	possibly damaging	0.92
R6360:Ipo7	UTSW	7	110027129	missense	probably damaging	1.00
R6776:Ipo7	UTSW	7	110047065	missense	probably damaging	0.98
R7132:Ipo7	UTSW	7	110054047	missense	probably benign	0.17
R7329:Ipo7	UTSW	7	110049017	missense	possibly damaging	0.94
R7491:Ipo7	UTSW	7	110039194	missense	possibly damaging	0.91
R7763:Ipo7	UTSW	7	110052799	missense	possibly damaging	0.62
R8070:Ipo7	UTSW	7	110052807	missense	probably benign	0.01
R8479:Ipo7	UTSW	7	110039245	missense	probably benign	0.23
R8547:Ipo7	UTSW	7	110052793	missense	probably benign	0.01
RF017:Ipo7	UTSW	7	110048794	missense	probably benign	0.00
X0062:Ipo7	UTSW	7	110052886	missense	probably damaging	1.00
X0066:Ipo7	UTSW	7	110052734	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- ACCGTTCTACAACAGCATGTC -3'
(R):5'- CACTTGTTTCCAAATGCTGGTATG -3'

Sequencing Primer
(F):5'- ACCGTTCTACAACAGCATGTCTTAGG -3'
(R):5'- CACACCAGGCTCATACATTTTTATG -3'

Posted On

2018-02-28