Mutagenetix > Incidental Mutation

Incidental Mutation 'R6254:Cdh1'

505990

Institutional Source

Beutler Lab

Gene Symbol

Cdh1

Ensembl Gene

ENSMUSG00000000303

Gene Name

cadherin 1

Synonyms

Ecad, UM, uvomorulin, E-cad, L-CAM, E-cadherin

MMRRC Submission

044371-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6254 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

106603351-106670246 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 106663798 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 590 (V590D)

Ref Sequence

ENSEMBL: ENSMUSP00000132112 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000312] [ENSMUST00000167688]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000000312
AA Change: V590D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000000312
Gene: ENSMUSG00000000303
AA Change: V590D

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Cadherin_pro	29	118	3.42e-36	SMART
low complexity region	123	131	N/A	INTRINSIC
CA	179	262	2.27e-14	SMART
CA	286	375	3.18e-27	SMART
CA	398	487	2e-10	SMART
CA	510	595	1.49e-18	SMART
Pfam:Cadherin	600	688	5.3e-11	PFAM
transmembrane domain	711	733	N/A	INTRINSIC
Pfam:Cadherin_C	734	881	1.3e-52	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000167688
AA Change: V590D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000132112
Gene: ENSMUSG00000000303
AA Change: V590D

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Cadherin_pro	29	118	3.42e-36	SMART
low complexity region	123	131	N/A	INTRINSIC
CA	179	262	2.27e-14	SMART
CA	286	375	3.18e-27	SMART
CA	398	487	2e-10	SMART
CA	510	595	1.49e-18	SMART
Pfam:Cadherin	600	688	7.1e-10	PFAM
transmembrane domain	711	733	N/A	INTRINSIC
Pfam:Cadherin_C	738	880	3.9e-50	PFAM

Meta Mutation Damage Score

0.6329

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.4%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: This gene encodes E-cadherin, a calcium-dependent cell adhesion molecule that functions in the establishment and maintenance of epithelial cell morphology during embryongenesis and adulthood. The encoded preproprotein undergoes proteolytic processing to generate a mature protein. Targeted mutations disrupting binding of calcium to the encoded protein in mice cause death in utero due to failed blastocyst and trophectoderm formation. This gene is located adjacent to a related cadherin gene on chromosome 8. [provided by RefSeq, Oct 2015]
PHENOTYPE: In mutant homozygotes, adhesive cells of the morula dissociate shortly after initial compaction, probably due to depletion of maternal protein. Mutant embryos fail to form a trophectodermal epithelium or blastocyst cavity, and die near implantation time. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932443I19Rik	A	G	8: 13,706,043	D26G	possibly damaging	Het
Adam6b	A	T	12: 113,489,570	L2F	probably damaging	Het
Ank2	T	A	3: 126,941,804		probably benign	Het
Anpep	T	G	7: 79,839,233	D369A	probably damaging	Het
App	T	C	16: 84,978,177	E599G	probably damaging	Het
Asphd1	C	T	7: 126,948,868	V88I	probably benign	Het
Atad5	A	T	11: 80,127,389	I1389F	probably damaging	Het
Blm	T	C	7: 80,480,342	N950S	probably benign	Het
Bsn	A	T	9: 108,111,866	M2229K	probably damaging	Het
Cacna2d2	A	G	9: 107,509,216	M181V	probably benign	Het
Cadps2	T	A	6: 23,329,163		probably null	Het
Cdk5rap2	G	A	4: 70,364,032	T160M	probably damaging	Het
Chrna5	A	G	9: 55,006,456	M325V	probably benign	Het
Clca3a2	A	G	3: 144,802,134	I116T	probably benign	Het
Cyp2c23	T	C	19: 44,005,463	K488R	probably benign	Het
Edil3	T	A	13: 89,319,729	I451N	probably damaging	Het
Exph5	T	G	9: 53,372,710	S364A	possibly damaging	Het
Fam84b	A	G	15: 60,823,801	I32T	probably damaging	Het
Fam98c	A	G	7: 29,154,517	S209P	probably damaging	Het
Fat3	G	A	9: 15,996,145	L2854F	probably benign	Het
Fbxo38	T	C	18: 62,505,500		probably null	Het
Fermt2	T	C	14: 45,476,059	D205G	probably damaging	Het
Fmnl1	G	A	11: 103,196,315		probably benign	Het
Fn3k	A	G	11: 121,435,068	E27G	probably damaging	Het
Foxj2	A	G	6: 122,838,139	H378R	probably damaging	Het
Fubp1	A	G	3: 152,232,408	K140E	possibly damaging	Het
Gm4788	A	G	1: 139,754,390	I156T	probably damaging	Het
Gm7694	A	T	1: 170,302,534	C98*	probably null	Het
Golgb1	T	C	16: 36,913,978	S1196P	probably damaging	Het
Gpm6a	G	A	8: 55,047,396		probably null	Het
Hltf	T	A	3: 20,063,829	N80K	possibly damaging	Het
Il1rap	G	A	16: 26,695,270	R251H	probably benign	Het
Ipo7	T	A	7: 110,049,060	D688E	probably benign	Het
Itgal	T	A	7: 127,325,203	N897K	probably damaging	Het
Itsn2	A	G	12: 4,624,982		probably null	Het
Kcnk13	A	G	12: 99,965,372		probably benign	Het
Kdm7a	A	G	6: 39,170,269	L248P	probably damaging	Het
Kmt2c	T	C	5: 25,349,874	E1254G	possibly damaging	Het
Ldah	G	A	12: 8,275,912		probably benign	Het
Lingo1	T	A	9: 56,620,087	D406V	possibly damaging	Het
Lrriq1	A	T	10: 103,215,451	V480E	probably benign	Het
Mtcl1	C	T	17: 66,358,134	R1142H	probably benign	Het
Mtmr3	G	A	11: 4,497,381	Q360*	probably null	Het
Muc6	T	C	7: 141,651,115	N252S	probably benign	Het
Naa20	T	C	2: 145,903,320	L4P	probably damaging	Het
Neb	T	A	2: 52,222,961	I4274L	probably benign	Het
Noa1	A	T	5: 77,309,669	F130I	probably benign	Het
Nrg4	G	T	9: 55,236,512	H87N	possibly damaging	Het
Olfr1024	T	A	2: 85,904,505	Y183F	probably damaging	Het
Olfr632	T	A	7: 103,937,534	H51Q	probably benign	Het
P3h3	C	T	6: 124,845,601	E536K	probably damaging	Het
Pcdhb11	T	C	18: 37,421,718	S34P	probably damaging	Het
Pik3r1	T	C	13: 101,689,406	T71A	possibly damaging	Het
Plaur	T	A	7: 24,466,800	C99S	possibly damaging	Het
Plekha5	G	A	6: 140,586,436	G501E	probably damaging	Het
Plxnd1	C	T	6: 115,977,960	V614M	probably benign	Het
Ppp2r3a	T	C	9: 101,148,587	D307G	possibly damaging	Het
Prl3d3	C	T	13: 27,157,470	S28F	possibly damaging	Het
Prpf40a	T	C	2: 53,157,915	M197V	probably benign	Het
Ptk7	C	A	17: 46,572,642	Q832H	probably damaging	Het
Qser1	T	C	2: 104,790,090	S126G	probably benign	Het
Rab3ip	A	T	10: 116,915,867	C332S	probably damaging	Het
Raly	C	A	2: 154,857,366	T30K	probably damaging	Het
Rbp2	G	T	9: 98,490,647	S13I	probably benign	Het
Rps6ka1	C	T	4: 133,867,224	M159I	possibly damaging	Het
Rufy3	C	T	5: 88,584,309	T57I	probably benign	Het
Samd4	A	G	14: 47,016,631	D184G	probably damaging	Het
Slc35f3	T	C	8: 126,321,094	C58R	possibly damaging	Het
Smarca4	T	C	9: 21,699,877	I1467T	probably damaging	Het
Spag17	T	G	3: 100,065,585	I1371S	probably benign	Het
Sptan1	T	C	2: 30,007,549	L1228P	possibly damaging	Het
Stk31	C	T	6: 49,421,697	A344V	probably benign	Het
Supt16	A	G	14: 52,170,834	W885R	probably damaging	Het
Tdrd9	T	A	12: 112,025,900		probably null	Het
Tmod1	A	G	4: 46,078,469		probably null	Het
Tnfsf13	A	C	11: 69,684,483		probably null	Het
Trim75	C	A	8: 64,983,442	E119*	probably null	Het
Wdr6	T	C	9: 108,574,911	Y591C	probably damaging	Het
Wdr86	C	T	5: 24,718,283	R137H	probably benign	Het
Ythdf1	T	A	2: 180,911,150	Y424F	probably damaging	Het
Zfp984	G	T	4: 147,756,186	S69R	possibly damaging	Het
Zyg11a	A	G	4: 108,181,794	F743L	probably damaging	Het

Other mutations in Cdh1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01147:Cdh1	APN	8	106660884	missense	probably damaging	1.00
IGL01405:Cdh1	APN	8	106649001	missense	probably damaging	0.97
IGL01410:Cdh1	APN	8	106657853	missense	probably benign	0.19
IGL01901:Cdh1	APN	8	106657760	missense	probably damaging	0.99
IGL02197:Cdh1	APN	8	106653786	missense	probably benign	0.29
IGL02580:Cdh1	APN	8	106649018	missense	probably benign	0.01
IGL02690:Cdh1	APN	8	106657884	missense	probably damaging	1.00
IGL02732:Cdh1	APN	8	106666323	missense	probably damaging	1.00
IGL02927:Cdh1	APN	8	106668511	missense	probably damaging	1.00
R1777:Cdh1	UTSW	8	106656835	missense	probably damaging	1.00
R1826:Cdh1	UTSW	8	106666266	missense	probably benign	0.03
R1892:Cdh1	UTSW	8	106664250	missense	possibly damaging	0.72
R2045:Cdh1	UTSW	8	106666182	splice site	probably benign
R2100:Cdh1	UTSW	8	106659668	missense	possibly damaging	0.57
R2104:Cdh1	UTSW	8	106653759	splice site	probably benign
R2118:Cdh1	UTSW	8	106664210	missense	probably benign
R2121:Cdh1	UTSW	8	106664210	missense	probably benign
R2124:Cdh1	UTSW	8	106664210	missense	probably benign
R2125:Cdh1	UTSW	8	106656840	missense	probably damaging	0.99
R2163:Cdh1	UTSW	8	106649081	missense	probably benign	0.01
R2165:Cdh1	UTSW	8	106664321	missense	probably damaging	1.00
R2266:Cdh1	UTSW	8	106662003	missense	probably benign
R2761:Cdh1	UTSW	8	106653849	missense	possibly damaging	0.90
R4547:Cdh1	UTSW	8	106663903	missense	probably damaging	1.00
R5131:Cdh1	UTSW	8	106663798	missense	possibly damaging	0.95
R5767:Cdh1	UTSW	8	106668555	missense	probably damaging	0.97
R5931:Cdh1	UTSW	8	106666332	critical splice donor site	probably null
R6397:Cdh1	UTSW	8	106604290	missense	possibly damaging	0.81
R6888:Cdh1	UTSW	8	106658314	missense	probably benign	0.09
R6928:Cdh1	UTSW	8	106661010	missense	possibly damaging	0.93
R6995:Cdh1	UTSW	8	106660913	missense	probably benign	0.02
R7110:Cdh1	UTSW	8	106668544	missense	possibly damaging	0.87
R8069:Cdh1	UTSW	8	106657773	missense	probably benign	0.26
R8260:Cdh1	UTSW	8	106604347	missense	probably benign	0.01
R8387:Cdh1	UTSW	8	106663869	missense	probably benign	0.02
R8762:Cdh1	UTSW	8	106659704	missense	probably damaging	1.00
R8881:Cdh1	UTSW	8	106666272	missense	probably benign	0.00
R8888:Cdh1	UTSW	8	106604339	missense	probably damaging	1.00
R8928:Cdh1	UTSW	8	106666238	small deletion	probably benign
R8929:Cdh1	UTSW	8	106666238	small deletion	probably benign
R8930:Cdh1	UTSW	8	106666238	small deletion	probably benign
R8932:Cdh1	UTSW	8	106666238	small deletion	probably benign
R9211:Cdh1	UTSW	8	106664330	missense	probably benign	0.01
R9472:Cdh1	UTSW	8	106653616	missense	probably damaging	1.00
Z1177:Cdh1	UTSW	8	106656839	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTGTCAGAAAGCCGAGACAAG -3'
(R):5'- GGCAGAGCCTCTCTAAAGACAG -3'

Sequencing Primer
(F):5'- GACAAGGACAGAGCGCC -3'
(R):5'- TCTCTAAAGACAGCGAGCCTTC -3'

Posted On

2018-02-28