Mutagenetix > Incidental Mutations

Incidental Mutation 'R6254:Smarca4'

505993

Institutional Source

Beutler Lab

Gene Symbol

Smarca4

Ensembl Gene

ENSMUSG00000032187

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4

Synonyms

SNF2beta, SW1/SNF, b2b508.1Clo, Brg1, b2b692Clo

MMRRC Submission

044371-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6254 (G1)

Quality Score

123.008

Status

Validated

Chromosome

Chromosomal Location

21616169-21704230 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 21699877 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1467 (I1467T)

Ref Sequence

ENSEMBL: ENSMUSP00000133922 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034707] [ENSMUST00000098948] [ENSMUST00000174008]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034707
AA Change: I1468T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000034707
Gene: ENSMUSG00000032187
AA Change: I1468T

Domain	Start	End	E-Value	Type
low complexity region	6	58	N/A	INTRINSIC
low complexity region	130	153	N/A	INTRINSIC
QLQ	170	206	3.98e-14	SMART
low complexity region	221	247	N/A	INTRINSIC
low complexity region	252	289	N/A	INTRINSIC
low complexity region	304	330	N/A	INTRINSIC
low complexity region	407	418	N/A	INTRINSIC
HSA	460	532	2e-27	SMART
coiled coil region	563	595	N/A	INTRINSIC
BRK	612	656	5.17e-21	SMART
low complexity region	657	672	N/A	INTRINSIC
low complexity region	691	702	N/A	INTRINSIC
DEXDc	750	942	5.17e-38	SMART
Blast:DEXDc	953	985	7e-10	BLAST
low complexity region	1019	1034	N/A	INTRINSIC
HELICc	1110	1194	7.27e-24	SMART
low complexity region	1252	1267	N/A	INTRINSIC
SnAC	1288	1356	2.8e-29	SMART
low complexity region	1360	1385	N/A	INTRINSIC
low complexity region	1388	1398	N/A	INTRINSIC
BROMO	1422	1533	4.19e-42	SMART
low complexity region	1534	1557	N/A	INTRINSIC
low complexity region	1578	1588	N/A	INTRINSIC
low complexity region	1594	1614	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098948
AA Change: I1471T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000096547
Gene: ENSMUSG00000032187
AA Change: I1471T

Domain	Start	End	E-Value	Type
low complexity region	6	58	N/A	INTRINSIC
low complexity region	130	153	N/A	INTRINSIC
QLQ	170	206	3.98e-14	SMART
low complexity region	221	247	N/A	INTRINSIC
low complexity region	252	289	N/A	INTRINSIC
low complexity region	304	330	N/A	INTRINSIC
low complexity region	407	418	N/A	INTRINSIC
HSA	460	532	2e-27	SMART
coiled coil region	563	595	N/A	INTRINSIC
BRK	612	656	5.17e-21	SMART
low complexity region	657	672	N/A	INTRINSIC
low complexity region	691	702	N/A	INTRINSIC
DEXDc	750	942	5.17e-38	SMART
Blast:DEXDc	953	985	7e-10	BLAST
low complexity region	1019	1034	N/A	INTRINSIC
HELICc	1110	1194	7.27e-24	SMART
low complexity region	1252	1267	N/A	INTRINSIC
SnAC	1288	1356	2.8e-29	SMART
low complexity region	1363	1388	N/A	INTRINSIC
low complexity region	1391	1401	N/A	INTRINSIC
BROMO	1425	1536	4.19e-42	SMART
low complexity region	1537	1560	N/A	INTRINSIC
low complexity region	1581	1591	N/A	INTRINSIC
low complexity region	1597	1617	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000174008
AA Change: I1467T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133922
Gene: ENSMUSG00000032187
AA Change: I1467T

Domain	Start	End	E-Value	Type
low complexity region	6	58	N/A	INTRINSIC
low complexity region	130	153	N/A	INTRINSIC
QLQ	170	206	3.98e-14	SMART
low complexity region	221	247	N/A	INTRINSIC
low complexity region	252	289	N/A	INTRINSIC
low complexity region	304	330	N/A	INTRINSIC
low complexity region	407	418	N/A	INTRINSIC
HSA	460	532	2e-27	SMART
coiled coil region	563	595	N/A	INTRINSIC
BRK	612	656	5.17e-21	SMART
low complexity region	657	672	N/A	INTRINSIC
low complexity region	691	702	N/A	INTRINSIC
DEXDc	750	942	5.17e-38	SMART
Blast:DEXDc	953	985	7e-10	BLAST
low complexity region	1019	1034	N/A	INTRINSIC
HELICc	1110	1194	7.27e-24	SMART
low complexity region	1252	1267	N/A	INTRINSIC
SnAC	1288	1356	2.8e-29	SMART
low complexity region	1360	1385	N/A	INTRINSIC
low complexity region	1388	1398	N/A	INTRINSIC
BROMO	1422	1532	1.36e-41	SMART
low complexity region	1533	1556	N/A	INTRINSIC
low complexity region	1577	1587	N/A	INTRINSIC
low complexity region	1593	1613	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.4%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. In addition, this protein can bind BRCA1, as well as regulate the expression of the tumorigenic protein CD44. Mutations in this gene cause rhabdoid tumor predisposition syndrome type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a null allele die in utero before implantation. Embryos heterozygous for this null allele and an ENU-induced allele show impaired definitive erythropoiesis, anemia and lethality during organogenesis. Heterozygotes for a different null allele show cyanosis and cardiovascular defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932443I19Rik	A	G	8: 13,706,043	D26G	possibly damaging	Het
Adam6b	A	T	12: 113,489,570	L2F	probably damaging	Het
Ank2	T	A	3: 126,941,804		probably benign	Het
Anpep	T	G	7: 79,839,233	D369A	probably damaging	Het
App	T	C	16: 84,978,177	E599G	probably damaging	Het
Asphd1	C	T	7: 126,948,868	V88I	probably benign	Het
Atad5	A	T	11: 80,127,389	I1389F	probably damaging	Het
Blm	T	C	7: 80,480,342	N950S	probably benign	Het
Bsn	A	T	9: 108,111,866	M2229K	probably damaging	Het
Cacna2d2	A	G	9: 107,509,216	M181V	probably benign	Het
Cadps2	T	A	6: 23,329,163		probably null	Het
Cdh1	T	A	8: 106,663,798	V590D	probably damaging	Het
Cdk5rap2	G	A	4: 70,364,032	T160M	probably damaging	Het
Chrna5	A	G	9: 55,006,456	M325V	probably benign	Het
Clca3a2	A	G	3: 144,802,134	I116T	probably benign	Het
Cyp2c23	T	C	19: 44,005,463	K488R	probably benign	Het
Edil3	T	A	13: 89,319,729	I451N	probably damaging	Het
Exph5	T	G	9: 53,372,710	S364A	possibly damaging	Het
Fam84b	A	G	15: 60,823,801	I32T	probably damaging	Het
Fam98c	A	G	7: 29,154,517	S209P	probably damaging	Het
Fat3	G	A	9: 15,996,145	L2854F	probably benign	Het
Fbxo38	T	C	18: 62,505,500		probably null	Het
Fermt2	T	C	14: 45,476,059	D205G	probably damaging	Het
Fmnl1	G	A	11: 103,196,315		probably benign	Het
Fn3k	A	G	11: 121,435,068	E27G	probably damaging	Het
Foxj2	A	G	6: 122,838,139	H378R	probably damaging	Het
Fubp1	A	G	3: 152,232,408	K140E	possibly damaging	Het
Gm4788	A	G	1: 139,754,390	I156T	probably damaging	Het
Gm7694	A	T	1: 170,302,534	C98*	probably null	Het
Golgb1	T	C	16: 36,913,978	S1196P	probably damaging	Het
Gpm6a	G	A	8: 55,047,396		probably null	Het
Hltf	T	A	3: 20,063,829	N80K	possibly damaging	Het
Il1rap	G	A	16: 26,695,270	R251H	probably benign	Het
Ipo7	T	A	7: 110,049,060	D688E	probably benign	Het
Itgal	T	A	7: 127,325,203	N897K	probably damaging	Het
Itsn2	A	G	12: 4,624,982		probably null	Het
Kcnk13	A	G	12: 99,965,372		probably benign	Het
Kdm7a	A	G	6: 39,170,269	L248P	probably damaging	Het
Kmt2c	T	C	5: 25,349,874	E1254G	possibly damaging	Het
Ldah	G	A	12: 8,275,912		probably benign	Het
Lingo1	T	A	9: 56,620,087	D406V	possibly damaging	Het
Lrriq1	A	T	10: 103,215,451	V480E	probably benign	Het
Mtcl1	C	T	17: 66,358,134	R1142H	probably benign	Het
Mtmr3	G	A	11: 4,497,381	Q360*	probably null	Het
Muc6	T	C	7: 141,651,115	N252S	probably benign	Het
Naa20	T	C	2: 145,903,320	L4P	probably damaging	Het
Neb	T	A	2: 52,222,961	I4274L	probably benign	Het
Noa1	A	T	5: 77,309,669	F130I	probably benign	Het
Nrg4	G	T	9: 55,236,512	H87N	possibly damaging	Het
Olfr1024	T	A	2: 85,904,505	Y183F	probably damaging	Het
Olfr632	T	A	7: 103,937,534	H51Q	probably benign	Het
P3h3	C	T	6: 124,845,601	E536K	probably damaging	Het
Pcdhb11	T	C	18: 37,421,718	S34P	probably damaging	Het
Pik3r1	T	C	13: 101,689,406	T71A	possibly damaging	Het
Plaur	T	A	7: 24,466,800	C99S	possibly damaging	Het
Plekha5	G	A	6: 140,586,436	G501E	probably damaging	Het
Plxnd1	C	T	6: 115,977,960	V614M	probably benign	Het
Ppp2r3a	T	C	9: 101,148,587	D307G	possibly damaging	Het
Prl3d3	C	T	13: 27,157,470	S28F	possibly damaging	Het
Prpf40a	T	C	2: 53,157,915	M197V	probably benign	Het
Ptk7	C	A	17: 46,572,642	Q832H	probably damaging	Het
Qser1	T	C	2: 104,790,090	S126G	probably benign	Het
Rab3ip	A	T	10: 116,915,867	C332S	probably damaging	Het
Raly	C	A	2: 154,857,366	T30K	probably damaging	Het
Rbp2	G	T	9: 98,490,647	S13I	probably benign	Het
Rps6ka1	C	T	4: 133,867,224	M159I	possibly damaging	Het
Rufy3	C	T	5: 88,584,309	T57I	probably benign	Het
Samd4	A	G	14: 47,016,631	D184G	probably damaging	Het
Slc35f3	T	C	8: 126,321,094	C58R	possibly damaging	Het
Spag17	T	G	3: 100,065,585	I1371S	probably benign	Het
Sptan1	T	C	2: 30,007,549	L1228P	possibly damaging	Het
Stk31	C	T	6: 49,421,697	A344V	probably benign	Het
Supt16	A	G	14: 52,170,834	W885R	probably damaging	Het
Tdrd9	T	A	12: 112,025,900		probably null	Het
Tmod1	A	G	4: 46,078,469		probably null	Het
Tnfsf13	A	C	11: 69,684,483		probably null	Het
Trim75	C	A	8: 64,983,442	E119*	probably null	Het
Wdr6	T	C	9: 108,574,911	Y591C	probably damaging	Het
Wdr86	C	T	5: 24,718,283	R137H	probably benign	Het
Ythdf1	T	A	2: 180,911,150	Y424F	probably damaging	Het
Zfp984	G	T	4: 147,756,186	S69R	possibly damaging	Het
Zyg11a	A	G	4: 108,181,794	F743L	probably damaging	Het

Other mutations in Smarca4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01380:Smarca4	APN	9	21679073	missense	probably benign	0.30
IGL01694:Smarca4	APN	9	21665870	missense	probably damaging	1.00
IGL02147:Smarca4	APN	9	21635703	missense	probably damaging	0.98
IGL02417:Smarca4	APN	9	21701090	missense	probably damaging	1.00
IGL02421:Smarca4	APN	9	21639239	missense	probably damaging	1.00
IGL02550:Smarca4	APN	9	21686122	missense	probably benign	0.25
IGL02794:Smarca4	APN	9	21673342	splice site	probably benign
IGL03030:Smarca4	APN	9	21635836	missense	probably benign	0.14
IGL03037:Smarca4	APN	9	21632935	unclassified	probably benign
IGL03069:Smarca4	APN	9	21635836	missense	probably benign	0.14
IGL03355:Smarca4	APN	9	21635836	missense	probably benign	0.14
R0123:Smarca4	UTSW	9	21637324	missense	probably damaging	1.00
R0134:Smarca4	UTSW	9	21637324	missense	probably damaging	1.00
R0230:Smarca4	UTSW	9	21700872	missense	probably damaging	0.99
R0269:Smarca4	UTSW	9	21636201	missense	probably benign	0.09
R0631:Smarca4	UTSW	9	21658984	splice site	probably benign
R0665:Smarca4	UTSW	9	21700943	small deletion	probably benign
R0726:Smarca4	UTSW	9	21700139	critical splice donor site	probably null
R0801:Smarca4	UTSW	9	21642554	missense	possibly damaging	0.81
R0918:Smarca4	UTSW	9	21636215	missense	probably benign	0.16
R1411:Smarca4	UTSW	9	21658955	missense	probably damaging	1.00
R1604:Smarca4	UTSW	9	21700943	small deletion	probably benign
R1768:Smarca4	UTSW	9	21701183	missense	possibly damaging	0.56
R2004:Smarca4	UTSW	9	21677480	missense	probably damaging	1.00
R2031:Smarca4	UTSW	9	21686062	missense	possibly damaging	0.68
R2211:Smarca4	UTSW	9	21686029	missense	probably damaging	1.00
R2512:Smarca4	UTSW	9	21635698	missense	possibly damaging	0.95
R2875:Smarca4	UTSW	9	21642580	missense	possibly damaging	0.55
R3786:Smarca4	UTSW	9	21672059	missense	possibly damaging	0.94
R4829:Smarca4	UTSW	9	21639327	missense	probably damaging	0.97
R5084:Smarca4	UTSW	9	21660763	missense	probably damaging	1.00
R5222:Smarca4	UTSW	9	21655706	missense	probably benign	0.01
R5785:Smarca4	UTSW	9	21686026	missense	probably damaging	0.99
R5844:Smarca4	UTSW	9	21677942	intron	probably benign
R5964:Smarca4	UTSW	9	21647430	missense	probably benign	0.00
R6001:Smarca4	UTSW	9	21632909	unclassified	probably benign
R6072:Smarca4	UTSW	9	21700121	missense	probably damaging	1.00
R6320:Smarca4	UTSW	9	21637375	missense	probably damaging	1.00
R6353:Smarca4	UTSW	9	21679149	critical splice donor site	probably null
R6461:Smarca4	UTSW	9	21679020	missense	probably damaging	1.00
R6886:Smarca4	UTSW	9	21658831	missense	probably damaging	1.00
R7098:Smarca4	UTSW	9	21634820	missense	probably benign	0.10
R7253:Smarca4	UTSW	9	21658960	missense	probably benign	0.01
R7307:Smarca4	UTSW	9	21638800	missense	probably damaging	1.00
R7382:Smarca4	UTSW	9	21658933	missense	probably damaging	0.98
R7445:Smarca4	UTSW	9	21686247	missense	probably damaging	1.00
R7535:Smarca4	UTSW	9	21647625	missense	possibly damaging	0.82
R7644:Smarca4	UTSW	9	21655654	missense	probably benign	0.00
R7734:Smarca4	UTSW	9	21667362	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- GCCAGTGGACCTCATTATCTG -3'
(R):5'- CATTGAGGCTGCGGTACTTG -3'

Sequencing Primer
(F):5'- AACGTAGAGATGCTCACCTTCGG -3'
(R):5'- ACTTGTGGTTTCGGATGCGTTC -3'

Posted On

2018-02-28