Incidental Mutation 'R6254:Wdr6'
ID506002
Institutional Source Beutler Lab
Gene Symbol Wdr6
Ensembl Gene ENSMUSG00000066357
Gene NameWD repeat domain 6
Synonyms
MMRRC Submission 044371-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.357) question?
Stock #R6254 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108572311-108578739 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108574911 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 591 (Y591C)
Ref Sequence ENSEMBL: ENSMUSP00000070927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006853] [ENSMUST00000019183] [ENSMUST00000068700] [ENSMUST00000193427] [ENSMUST00000195249]
Predicted Effect probably benign
Transcript: ENSMUST00000006853
SMART Domains Protein: ENSMUSP00000006853
Gene: ENSMUSG00000006675

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
P4Hc 143 460 1.26e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019183
SMART Domains Protein: ENSMUSP00000019183
Gene: ENSMUSG00000019039

DomainStartEndE-ValueType
low complexity region 288 301 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
DALR_1 399 538 2.09e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000068700
AA Change: Y591C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070927
Gene: ENSMUSG00000066357
AA Change: Y591C

DomainStartEndE-ValueType
Blast:WD40 109 142 3e-6 BLAST
WD40 198 237 1.42e-4 SMART
WD40 247 284 7.28e-2 SMART
WD40 286 326 1.72e-3 SMART
Blast:WD40 336 375 3e-13 BLAST
WD40 479 519 2.96e1 SMART
low complexity region 537 552 N/A INTRINSIC
WD40 559 598 1.77e2 SMART
Blast:WD40 600 641 7e-20 BLAST
Blast:WD40 764 815 2e-22 BLAST
Blast:WD40 855 896 2e-11 BLAST
WD40 900 949 1.48e1 SMART
WD40 973 1015 5.52e-2 SMART
WD40 1035 1076 3.98e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191897
Predicted Effect probably benign
Transcript: ENSMUST00000192518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193044
Predicted Effect probably benign
Transcript: ENSMUST00000193427
SMART Domains Protein: ENSMUSP00000141748
Gene: ENSMUSG00000019039

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
DALR_1 68 171 1.3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193846
Predicted Effect probably benign
Transcript: ENSMUST00000195249
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.4%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. The encoded protein interacts with serine/threonine kinase 11, and is implicated in cell growth arrest. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik A G 8: 13,706,043 D26G possibly damaging Het
Adam6b A T 12: 113,489,570 L2F probably damaging Het
Ank2 T A 3: 126,941,804 probably benign Het
Anpep T G 7: 79,839,233 D369A probably damaging Het
App T C 16: 84,978,177 E599G probably damaging Het
Asphd1 C T 7: 126,948,868 V88I probably benign Het
Atad5 A T 11: 80,127,389 I1389F probably damaging Het
Blm T C 7: 80,480,342 N950S probably benign Het
Bsn A T 9: 108,111,866 M2229K probably damaging Het
Cacna2d2 A G 9: 107,509,216 M181V probably benign Het
Cadps2 T A 6: 23,329,163 probably null Het
Cdh1 T A 8: 106,663,798 V590D probably damaging Het
Cdk5rap2 G A 4: 70,364,032 T160M probably damaging Het
Chrna5 A G 9: 55,006,456 M325V probably benign Het
Clca3a2 A G 3: 144,802,134 I116T probably benign Het
Cyp2c23 T C 19: 44,005,463 K488R probably benign Het
Edil3 T A 13: 89,319,729 I451N probably damaging Het
Exph5 T G 9: 53,372,710 S364A possibly damaging Het
Fam84b A G 15: 60,823,801 I32T probably damaging Het
Fam98c A G 7: 29,154,517 S209P probably damaging Het
Fat3 G A 9: 15,996,145 L2854F probably benign Het
Fbxo38 T C 18: 62,505,500 probably null Het
Fermt2 T C 14: 45,476,059 D205G probably damaging Het
Fmnl1 G A 11: 103,196,315 probably benign Het
Fn3k A G 11: 121,435,068 E27G probably damaging Het
Foxj2 A G 6: 122,838,139 H378R probably damaging Het
Fubp1 A G 3: 152,232,408 K140E possibly damaging Het
Gm4788 A G 1: 139,754,390 I156T probably damaging Het
Gm7694 A T 1: 170,302,534 C98* probably null Het
Golgb1 T C 16: 36,913,978 S1196P probably damaging Het
Gpm6a G A 8: 55,047,396 probably null Het
Hltf T A 3: 20,063,829 N80K possibly damaging Het
Il1rap G A 16: 26,695,270 R251H probably benign Het
Ipo7 T A 7: 110,049,060 D688E probably benign Het
Itgal T A 7: 127,325,203 N897K probably damaging Het
Itsn2 A G 12: 4,624,982 probably null Het
Kcnk13 A G 12: 99,965,372 probably benign Het
Kdm7a A G 6: 39,170,269 L248P probably damaging Het
Kmt2c T C 5: 25,349,874 E1254G possibly damaging Het
Ldah G A 12: 8,275,912 probably benign Het
Lingo1 T A 9: 56,620,087 D406V possibly damaging Het
Lrriq1 A T 10: 103,215,451 V480E probably benign Het
Mtcl1 C T 17: 66,358,134 R1142H probably benign Het
Mtmr3 G A 11: 4,497,381 Q360* probably null Het
Muc6 T C 7: 141,651,115 N252S probably benign Het
Naa20 T C 2: 145,903,320 L4P probably damaging Het
Neb T A 2: 52,222,961 I4274L probably benign Het
Noa1 A T 5: 77,309,669 F130I probably benign Het
Nrg4 G T 9: 55,236,512 H87N possibly damaging Het
Olfr1024 T A 2: 85,904,505 Y183F probably damaging Het
Olfr632 T A 7: 103,937,534 H51Q probably benign Het
P3h3 C T 6: 124,845,601 E536K probably damaging Het
Pcdhb11 T C 18: 37,421,718 S34P probably damaging Het
Pik3r1 T C 13: 101,689,406 T71A possibly damaging Het
Plaur T A 7: 24,466,800 C99S possibly damaging Het
Plekha5 G A 6: 140,586,436 G501E probably damaging Het
Plxnd1 C T 6: 115,977,960 V614M probably benign Het
Ppp2r3a T C 9: 101,148,587 D307G possibly damaging Het
Prl3d3 C T 13: 27,157,470 S28F possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Ptk7 C A 17: 46,572,642 Q832H probably damaging Het
Qser1 T C 2: 104,790,090 S126G probably benign Het
Rab3ip A T 10: 116,915,867 C332S probably damaging Het
Raly C A 2: 154,857,366 T30K probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rps6ka1 C T 4: 133,867,224 M159I possibly damaging Het
Rufy3 C T 5: 88,584,309 T57I probably benign Het
Samd4 A G 14: 47,016,631 D184G probably damaging Het
Slc35f3 T C 8: 126,321,094 C58R possibly damaging Het
Smarca4 T C 9: 21,699,877 I1467T probably damaging Het
Spag17 T G 3: 100,065,585 I1371S probably benign Het
Sptan1 T C 2: 30,007,549 L1228P possibly damaging Het
Stk31 C T 6: 49,421,697 A344V probably benign Het
Supt16 A G 14: 52,170,834 W885R probably damaging Het
Tdrd9 T A 12: 112,025,900 probably null Het
Tmod1 A G 4: 46,078,469 probably null Het
Tnfsf13 A C 11: 69,684,483 probably null Het
Trim75 C A 8: 64,983,442 E119* probably null Het
Wdr86 C T 5: 24,718,283 R137H probably benign Het
Ythdf1 T A 2: 180,911,150 Y424F probably damaging Het
Zfp984 G T 4: 147,756,186 S69R possibly damaging Het
Zyg11a A G 4: 108,181,794 F743L probably damaging Het
Other mutations in Wdr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Wdr6 APN 9 108574897 missense possibly damaging 0.77
IGL01757:Wdr6 APN 9 108576228 missense possibly damaging 0.65
IGL02096:Wdr6 APN 9 108576553 missense probably damaging 1.00
IGL02577:Wdr6 APN 9 108575941 missense possibly damaging 0.88
IGL02625:Wdr6 APN 9 108575505 missense probably damaging 1.00
IGL02820:Wdr6 APN 9 108578544 missense probably benign 0.28
IGL03250:Wdr6 APN 9 108573197 missense possibly damaging 0.95
PIT4802001:Wdr6 UTSW 9 108574566 missense probably damaging 1.00
R0038:Wdr6 UTSW 9 108572969 missense probably damaging 1.00
R0153:Wdr6 UTSW 9 108575242 missense probably damaging 1.00
R0378:Wdr6 UTSW 9 108575864 missense probably damaging 1.00
R0420:Wdr6 UTSW 9 108573101 missense probably benign 0.41
R1620:Wdr6 UTSW 9 108574655 missense possibly damaging 0.51
R1753:Wdr6 UTSW 9 108575164 missense probably damaging 0.99
R1844:Wdr6 UTSW 9 108575977 missense probably damaging 1.00
R1881:Wdr6 UTSW 9 108573179 splice site probably null
R1987:Wdr6 UTSW 9 108576534 missense probably damaging 1.00
R2029:Wdr6 UTSW 9 108575355 missense probably damaging 1.00
R2139:Wdr6 UTSW 9 108574123 missense probably benign 0.00
R3900:Wdr6 UTSW 9 108575769 missense probably damaging 1.00
R4021:Wdr6 UTSW 9 108575206 missense probably damaging 1.00
R4909:Wdr6 UTSW 9 108572988 missense probably benign 0.28
R5073:Wdr6 UTSW 9 108574366 missense probably damaging 1.00
R5748:Wdr6 UTSW 9 108575782 missense possibly damaging 0.75
R6039:Wdr6 UTSW 9 108573795 frame shift probably null
R6039:Wdr6 UTSW 9 108573795 frame shift probably null
R6724:Wdr6 UTSW 9 108574894 missense probably benign 0.11
R7134:Wdr6 UTSW 9 108573365 missense probably damaging 1.00
R7248:Wdr6 UTSW 9 108576039 missense possibly damaging 0.82
R7296:Wdr6 UTSW 9 108574585 missense probably damaging 1.00
R7388:Wdr6 UTSW 9 108574772 missense probably damaging 1.00
R7443:Wdr6 UTSW 9 108574290 missense probably damaging 1.00
R7467:Wdr6 UTSW 9 108573002 missense probably benign 0.14
R7672:Wdr6 UTSW 9 108573748 missense probably benign 0.06
R7699:Wdr6 UTSW 9 108576361 missense possibly damaging 0.92
R7700:Wdr6 UTSW 9 108576361 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCCTCAGTATCAGAAAAGGCC -3'
(R):5'- GCTATTACTGCAGCTGAGGC -3'

Sequencing Primer
(F):5'- CACAGTTGACGATATGCAGCTTC -3'
(R):5'- TATTACTGCAGCTGAGGCACCTG -3'
Posted On2018-02-28