Incidental Mutation 'R6254:Lrriq1'
ID 506003
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Name leucine-rich repeats and IQ motif containing 1
Synonyms Gm1557, LOC380658, 4930503E15Rik
MMRRC Submission 044371-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R6254 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 102881892-103072183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 103051312 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 480 (V480E)
Ref Sequence ENSEMBL: ENSMUSP00000131419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]
AlphaFold Q0P5X1
Predicted Effect probably benign
Transcript: ENSMUST00000020043
AA Change: V480E

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: V480E

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 1e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123364
AA Change: V480E

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892
AA Change: V480E

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
Blast:IQ 290 312 6e-6 BLAST
coiled coil region 314 390 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166240
AA Change: V480E

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: V480E

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220380
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.4%
Validation Efficiency 100% (82/82)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A T 12: 113,453,190 (GRCm39) L2F probably damaging Het
Ank2 T A 3: 126,735,453 (GRCm39) probably benign Het
Anpep T G 7: 79,488,981 (GRCm39) D369A probably damaging Het
App T C 16: 84,775,065 (GRCm39) E599G probably damaging Het
Asphd1 C T 7: 126,548,040 (GRCm39) V88I probably benign Het
Atad5 A T 11: 80,018,215 (GRCm39) I1389F probably damaging Het
Blm T C 7: 80,130,090 (GRCm39) N950S probably benign Het
Bsn A T 9: 107,989,065 (GRCm39) M2229K probably damaging Het
Cacna2d2 A G 9: 107,386,415 (GRCm39) M181V probably benign Het
Cadps2 T A 6: 23,329,162 (GRCm39) probably null Het
Cdh1 T A 8: 107,390,430 (GRCm39) V590D probably damaging Het
Cdk5rap2 G A 4: 70,282,269 (GRCm39) T160M probably damaging Het
Cfap97d2 A G 8: 13,756,043 (GRCm39) D26G possibly damaging Het
Cfhr4 A G 1: 139,682,128 (GRCm39) I156T probably damaging Het
Chrna5 A G 9: 54,913,740 (GRCm39) M325V probably benign Het
Clca3a2 A G 3: 144,507,895 (GRCm39) I116T probably benign Het
Cyp2c23 T C 19: 43,993,902 (GRCm39) K488R probably benign Het
Edil3 T A 13: 89,467,848 (GRCm39) I451N probably damaging Het
Exph5 T G 9: 53,284,010 (GRCm39) S364A possibly damaging Het
Fam98c A G 7: 28,853,942 (GRCm39) S209P probably damaging Het
Fat3 G A 9: 15,907,441 (GRCm39) L2854F probably benign Het
Fbxo38 T C 18: 62,638,571 (GRCm39) probably null Het
Fermt2 T C 14: 45,713,516 (GRCm39) D205G probably damaging Het
Fmnl1 G A 11: 103,087,141 (GRCm39) probably benign Het
Fn3k A G 11: 121,325,894 (GRCm39) E27G probably damaging Het
Foxj2 A G 6: 122,815,098 (GRCm39) H378R probably damaging Het
Fubp1 A G 3: 151,938,045 (GRCm39) K140E possibly damaging Het
Gm7694 A T 1: 170,130,103 (GRCm39) C98* probably null Het
Golgb1 T C 16: 36,734,340 (GRCm39) S1196P probably damaging Het
Gpm6a G A 8: 55,500,431 (GRCm39) probably null Het
Hltf T A 3: 20,117,993 (GRCm39) N80K possibly damaging Het
Il1rap G A 16: 26,514,020 (GRCm39) R251H probably benign Het
Ipo7 T A 7: 109,648,267 (GRCm39) D688E probably benign Het
Itgal T A 7: 126,924,375 (GRCm39) N897K probably damaging Het
Itsn2 A G 12: 4,674,982 (GRCm39) probably null Het
Kcnk13 A G 12: 99,931,631 (GRCm39) probably benign Het
Kdm7a A G 6: 39,147,203 (GRCm39) L248P probably damaging Het
Kmt2c T C 5: 25,554,872 (GRCm39) E1254G possibly damaging Het
Ldah G A 12: 8,325,912 (GRCm39) probably benign Het
Lingo1 T A 9: 56,527,371 (GRCm39) D406V possibly damaging Het
Lratd2 A G 15: 60,695,650 (GRCm39) I32T probably damaging Het
Mtcl1 C T 17: 66,665,129 (GRCm39) R1142H probably benign Het
Mtmr3 G A 11: 4,447,381 (GRCm39) Q360* probably null Het
Muc6 T C 7: 141,237,380 (GRCm39) N252S probably benign Het
Naa20 T C 2: 145,745,240 (GRCm39) L4P probably damaging Het
Neb T A 2: 52,112,973 (GRCm39) I4274L probably benign Het
Noa1 A T 5: 77,457,516 (GRCm39) F130I probably benign Het
Nrg4 G T 9: 55,143,796 (GRCm39) H87N possibly damaging Het
Or51ai2 T A 7: 103,586,741 (GRCm39) H51Q probably benign Het
Or5m12 T A 2: 85,734,849 (GRCm39) Y183F probably damaging Het
P3h3 C T 6: 124,822,564 (GRCm39) E536K probably damaging Het
Pcdhb11 T C 18: 37,554,771 (GRCm39) S34P probably damaging Het
Pik3r1 T C 13: 101,825,914 (GRCm39) T71A possibly damaging Het
Plaur T A 7: 24,166,225 (GRCm39) C99S possibly damaging Het
Plekha5 G A 6: 140,532,162 (GRCm39) G501E probably damaging Het
Plxnd1 C T 6: 115,954,921 (GRCm39) V614M probably benign Het
Ppp2r3d T C 9: 101,025,786 (GRCm39) D307G possibly damaging Het
Prl3d3 C T 13: 27,341,453 (GRCm39) S28F possibly damaging Het
Prpf40a T C 2: 53,047,927 (GRCm39) M197V probably benign Het
Ptk7 C A 17: 46,883,568 (GRCm39) Q832H probably damaging Het
Qser1 T C 2: 104,620,435 (GRCm39) S126G probably benign Het
Rab3ip A T 10: 116,751,772 (GRCm39) C332S probably damaging Het
Raly C A 2: 154,699,286 (GRCm39) T30K probably damaging Het
Rbp2 G T 9: 98,372,700 (GRCm39) S13I probably benign Het
Rps6ka1 C T 4: 133,594,535 (GRCm39) M159I possibly damaging Het
Rufy3 C T 5: 88,732,168 (GRCm39) T57I probably benign Het
Samd4 A G 14: 47,254,088 (GRCm39) D184G probably damaging Het
Slc35f3 T C 8: 127,047,833 (GRCm39) C58R possibly damaging Het
Smarca4 T C 9: 21,611,173 (GRCm39) I1467T probably damaging Het
Spag17 T G 3: 99,972,901 (GRCm39) I1371S probably benign Het
Sptan1 T C 2: 29,897,561 (GRCm39) L1228P possibly damaging Het
Stk31 C T 6: 49,398,631 (GRCm39) A344V probably benign Het
Supt16 A G 14: 52,408,291 (GRCm39) W885R probably damaging Het
Tdrd9 T A 12: 111,992,334 (GRCm39) probably null Het
Tmod1 A G 4: 46,078,469 (GRCm39) probably null Het
Tnfsf13 A C 11: 69,575,309 (GRCm39) probably null Het
Trim75 C A 8: 65,436,094 (GRCm39) E119* probably null Het
Wdr6 T C 9: 108,452,110 (GRCm39) Y591C probably damaging Het
Wdr86 C T 5: 24,923,281 (GRCm39) R137H probably benign Het
Ythdf1 T A 2: 180,552,943 (GRCm39) Y424F probably damaging Het
Zfp984 G T 4: 147,840,643 (GRCm39) S69R possibly damaging Het
Zyg11a A G 4: 108,038,991 (GRCm39) F743L probably damaging Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 102,997,757 (GRCm39) missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103,053,977 (GRCm39) nonsense probably null
IGL01637:Lrriq1 APN 10 103,051,489 (GRCm39) missense probably benign
IGL02019:Lrriq1 APN 10 103,014,661 (GRCm39) missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103,006,340 (GRCm39) missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103,060,802 (GRCm39) missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103,070,024 (GRCm39) splice site probably benign
IGL02408:Lrriq1 APN 10 102,982,142 (GRCm39) missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103,036,500 (GRCm39) missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103,050,880 (GRCm39) missense probably benign 0.02
IGL02558:Lrriq1 APN 10 102,982,144 (GRCm39) missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 102,980,409 (GRCm39) missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103,057,322 (GRCm39) critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103,063,057 (GRCm39) missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 102,907,055 (GRCm39) missense probably benign 0.26
R0050:Lrriq1 UTSW 10 102,904,792 (GRCm39) missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 102,904,792 (GRCm39) missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 102,899,279 (GRCm39) missense probably benign 0.02
R0068:Lrriq1 UTSW 10 102,899,279 (GRCm39) missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103,006,281 (GRCm39) critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103,051,634 (GRCm39) missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103,057,150 (GRCm39) missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 102,904,829 (GRCm39) splice site probably null
R0522:Lrriq1 UTSW 10 102,997,638 (GRCm39) missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103,069,905 (GRCm39) missense probably benign
R1220:Lrriq1 UTSW 10 102,906,990 (GRCm39) missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103,069,998 (GRCm39) missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103,069,998 (GRCm39) missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103,038,376 (GRCm39) splice site probably benign
R1642:Lrriq1 UTSW 10 103,050,317 (GRCm39) missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103,050,685 (GRCm39) missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103,006,509 (GRCm39) nonsense probably null
R1830:Lrriq1 UTSW 10 102,997,620 (GRCm39) missense probably benign
R1843:Lrriq1 UTSW 10 103,063,034 (GRCm39) splice site probably null
R2128:Lrriq1 UTSW 10 103,050,718 (GRCm39) missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103,050,718 (GRCm39) missense probably benign 0.01
R2199:Lrriq1 UTSW 10 102,904,774 (GRCm39) missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103,025,848 (GRCm39) missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103,038,242 (GRCm39) missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103,063,111 (GRCm39) missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103,063,111 (GRCm39) missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103,050,536 (GRCm39) missense probably benign 0.00
R2939:Lrriq1 UTSW 10 102,980,750 (GRCm39) missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R3081:Lrriq1 UTSW 10 102,980,750 (GRCm39) missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103,006,294 (GRCm39) missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103,006,717 (GRCm39) missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103,051,972 (GRCm39) missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103,051,972 (GRCm39) missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103,051,967 (GRCm39) missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103,038,225 (GRCm39) missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103,057,288 (GRCm39) missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103,036,424 (GRCm39) nonsense probably null
R4663:Lrriq1 UTSW 10 102,899,273 (GRCm39) missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103,051,610 (GRCm39) missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103,006,327 (GRCm39) missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103,057,179 (GRCm39) missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103,057,179 (GRCm39) missense probably benign 0.02
R4815:Lrriq1 UTSW 10 102,980,739 (GRCm39) missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103,014,649 (GRCm39) missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103,069,899 (GRCm39) missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 102,997,613 (GRCm39) missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103,036,420 (GRCm39) missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103,036,420 (GRCm39) missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103,025,784 (GRCm39) missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103,025,784 (GRCm39) missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103,023,314 (GRCm39) missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103,051,206 (GRCm39) missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103,050,448 (GRCm39) missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103,006,457 (GRCm39) missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103,051,301 (GRCm39) missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103,009,236 (GRCm39) missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103,057,243 (GRCm39) nonsense probably null
R6008:Lrriq1 UTSW 10 103,006,325 (GRCm39) missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103,051,395 (GRCm39) missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103,051,618 (GRCm39) missense probably damaging 1.00
R6311:Lrriq1 UTSW 10 103,009,254 (GRCm39) missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103,036,559 (GRCm39) missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103,063,045 (GRCm39) missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103,057,293 (GRCm39) missense probably benign 0.06
R6719:Lrriq1 UTSW 10 102,906,977 (GRCm39) missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103,017,750 (GRCm39) critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103,050,800 (GRCm39) missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103,023,319 (GRCm39) missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103,060,826 (GRCm39) missense probably benign
R7241:Lrriq1 UTSW 10 103,051,834 (GRCm39) missense probably damaging 1.00
R7248:Lrriq1 UTSW 10 103,059,611 (GRCm39) missense possibly damaging 0.85
R7287:Lrriq1 UTSW 10 103,051,877 (GRCm39) missense probably benign 0.00
R7402:Lrriq1 UTSW 10 103,057,185 (GRCm39) missense possibly damaging 0.87
R7439:Lrriq1 UTSW 10 103,050,380 (GRCm39) missense probably benign 0.21
R7585:Lrriq1 UTSW 10 103,050,807 (GRCm39) missense possibly damaging 0.93
R7611:Lrriq1 UTSW 10 103,036,432 (GRCm39) missense possibly damaging 0.54
R7634:Lrriq1 UTSW 10 103,036,462 (GRCm39) missense probably damaging 1.00
R7767:Lrriq1 UTSW 10 103,051,815 (GRCm39) missense probably damaging 0.99
R7809:Lrriq1 UTSW 10 103,051,678 (GRCm39) missense probably damaging 0.99
R7910:Lrriq1 UTSW 10 103,051,055 (GRCm39) nonsense probably null
R8131:Lrriq1 UTSW 10 103,051,572 (GRCm39) missense possibly damaging 0.57
R8156:Lrriq1 UTSW 10 102,992,196 (GRCm39) critical splice donor site probably null
R8211:Lrriq1 UTSW 10 103,006,408 (GRCm39) missense probably damaging 1.00
R8304:Lrriq1 UTSW 10 103,069,929 (GRCm39) missense possibly damaging 0.57
R8487:Lrriq1 UTSW 10 103,050,914 (GRCm39) missense probably damaging 0.98
R8500:Lrriq1 UTSW 10 102,882,016 (GRCm39) missense
R9013:Lrriq1 UTSW 10 103,050,931 (GRCm39) missense probably damaging 1.00
R9099:Lrriq1 UTSW 10 103,051,864 (GRCm39) missense probably damaging 0.98
R9155:Lrriq1 UTSW 10 103,050,640 (GRCm39) missense probably benign 0.03
R9320:Lrriq1 UTSW 10 103,057,144 (GRCm39) missense probably benign
R9384:Lrriq1 UTSW 10 103,006,458 (GRCm39) missense probably benign 0.00
R9469:Lrriq1 UTSW 10 103,050,761 (GRCm39) missense probably benign 0.07
R9585:Lrriq1 UTSW 10 103,051,250 (GRCm39) missense probably benign
R9706:Lrriq1 UTSW 10 102,881,902 (GRCm39) missense
R9780:Lrriq1 UTSW 10 103,025,824 (GRCm39) missense probably damaging 1.00
X0026:Lrriq1 UTSW 10 103,051,565 (GRCm39) nonsense probably null
Z1088:Lrriq1 UTSW 10 103,038,307 (GRCm39) missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103,069,946 (GRCm39) missense probably damaging 0.99
Z1176:Lrriq1 UTSW 10 103,038,221 (GRCm39) missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103,038,220 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTCTAGTCCTTGCCACG -3'
(R):5'- TTTAAAGAAAGGAGATTGCCATGGC -3'

Sequencing Primer
(F):5'- TAGTCCTTGCCACGGGTACTG -3'
(R):5'- AAGAAGATGCTTGCCTCG -3'
Posted On 2018-02-28