Incidental Mutation 'R6254:Tnfsf13'
ID506006
Institutional Source Beutler Lab
Gene Symbol Tnfsf13
Ensembl Gene ENSMUSG00000089669
Gene Nametumor necrosis factor (ligand) superfamily, member 13
SynonymsAPRIL, 2310026N09Rik, TRDL1, TALL2
MMRRC Submission 044371-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6254 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location69682846-69685784 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 69684483 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005336] [ENSMUST00000018896] [ENSMUST00000066760] [ENSMUST00000108648] [ENSMUST00000108649] [ENSMUST00000174159] [ENSMUST00000180587] [ENSMUST00000181261] [ENSMUST00000181810]
Predicted Effect probably benign
Transcript: ENSMUST00000005336
SMART Domains Protein: ENSMUSP00000005336
Gene: ENSMUSG00000005204

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
Pfam:Peptidase_C48 394 566 4.9e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000018896
SMART Domains Protein: ENSMUSP00000018896
Gene: ENSMUSG00000089669

DomainStartEndE-ValueType
Blast:TNF 39 87 1e-22 BLAST
low complexity region 101 106 N/A INTRINSIC
TNF 107 240 7.41e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066760
SMART Domains Protein: ENSMUSP00000066581
Gene: ENSMUSG00000005204

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
Pfam:Peptidase_C48 394 566 4.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108648
SMART Domains Protein: ENSMUSP00000104288
Gene: ENSMUSG00000089669

DomainStartEndE-ValueType
Blast:TNF 39 87 1e-22 BLAST
TNF 97 224 6.21e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108649
SMART Domains Protein: ENSMUSP00000104289
Gene: ENSMUSG00000018752

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
PDB:4HT1|T 110 166 1e-31 PDB
Blast:TNF 117 166 4e-27 BLAST
low complexity region 190 195 N/A INTRINSIC
TNF 196 329 7.41e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145435
Predicted Effect probably null
Transcript: ENSMUST00000174159
SMART Domains Protein: ENSMUSP00000133951
Gene: ENSMUSG00000018752

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
TNF 117 255 6.18e-10 SMART
low complexity region 269 274 N/A INTRINSIC
TNF 275 408 7.41e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000180587
SMART Domains Protein: ENSMUSP00000137973
Gene: ENSMUSG00000018752

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
TNF 118 256 6.18e-10 SMART
low complexity region 270 275 N/A INTRINSIC
TNF 276 410 1.91e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181261
SMART Domains Protein: ENSMUSP00000137916
Gene: ENSMUSG00000097328

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
Blast:TNF 72 98 8e-8 BLAST
PDB:4HT1|T 72 98 1e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000181810
SMART Domains Protein: ENSMUSP00000137972
Gene: ENSMUSG00000097328

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
TNF 117 248 3.67e-35 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.4%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tumor necrosis factor (TNF) ligand family. This protein is a ligand for TNFRSF17/BCMA, a member of the TNF receptor family. This protein and its receptor are both found to be important for B cell development. In vitro experiments suggested that this protein may be able to induce apoptosis through its interaction with other TNF receptor family proteins such as TNFRSF6/FAS and TNFRSF14/HVEM. Alternative splicing results in multiple transcript variants. Some transcripts that skip the last exon of the upstream gene (TNFSF12) and continue into the second exon of this gene have been identified; such read-through transcripts are contained in GeneID 407977, TNFSF12-TNFSF13. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous null mice are viable and fertile. No apparent defects of the immune system have been reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik A G 8: 13,706,043 D26G possibly damaging Het
Adam6b A T 12: 113,489,570 L2F probably damaging Het
Ank2 T A 3: 126,941,804 probably benign Het
Anpep T G 7: 79,839,233 D369A probably damaging Het
App T C 16: 84,978,177 E599G probably damaging Het
Asphd1 C T 7: 126,948,868 V88I probably benign Het
Atad5 A T 11: 80,127,389 I1389F probably damaging Het
Blm T C 7: 80,480,342 N950S probably benign Het
Bsn A T 9: 108,111,866 M2229K probably damaging Het
Cacna2d2 A G 9: 107,509,216 M181V probably benign Het
Cadps2 T A 6: 23,329,163 probably null Het
Cdh1 T A 8: 106,663,798 V590D probably damaging Het
Cdk5rap2 G A 4: 70,364,032 T160M probably damaging Het
Chrna5 A G 9: 55,006,456 M325V probably benign Het
Clca3a2 A G 3: 144,802,134 I116T probably benign Het
Cyp2c23 T C 19: 44,005,463 K488R probably benign Het
Edil3 T A 13: 89,319,729 I451N probably damaging Het
Exph5 T G 9: 53,372,710 S364A possibly damaging Het
Fam84b A G 15: 60,823,801 I32T probably damaging Het
Fam98c A G 7: 29,154,517 S209P probably damaging Het
Fat3 G A 9: 15,996,145 L2854F probably benign Het
Fbxo38 T C 18: 62,505,500 probably null Het
Fermt2 T C 14: 45,476,059 D205G probably damaging Het
Fmnl1 G A 11: 103,196,315 probably benign Het
Fn3k A G 11: 121,435,068 E27G probably damaging Het
Foxj2 A G 6: 122,838,139 H378R probably damaging Het
Fubp1 A G 3: 152,232,408 K140E possibly damaging Het
Gm4788 A G 1: 139,754,390 I156T probably damaging Het
Gm7694 A T 1: 170,302,534 C98* probably null Het
Golgb1 T C 16: 36,913,978 S1196P probably damaging Het
Gpm6a G A 8: 55,047,396 probably null Het
Hltf T A 3: 20,063,829 N80K possibly damaging Het
Il1rap G A 16: 26,695,270 R251H probably benign Het
Ipo7 T A 7: 110,049,060 D688E probably benign Het
Itgal T A 7: 127,325,203 N897K probably damaging Het
Itsn2 A G 12: 4,624,982 probably null Het
Kcnk13 A G 12: 99,965,372 probably benign Het
Kdm7a A G 6: 39,170,269 L248P probably damaging Het
Kmt2c T C 5: 25,349,874 E1254G possibly damaging Het
Ldah G A 12: 8,275,912 probably benign Het
Lingo1 T A 9: 56,620,087 D406V possibly damaging Het
Lrriq1 A T 10: 103,215,451 V480E probably benign Het
Mtcl1 C T 17: 66,358,134 R1142H probably benign Het
Mtmr3 G A 11: 4,497,381 Q360* probably null Het
Muc6 T C 7: 141,651,115 N252S probably benign Het
Naa20 T C 2: 145,903,320 L4P probably damaging Het
Neb T A 2: 52,222,961 I4274L probably benign Het
Noa1 A T 5: 77,309,669 F130I probably benign Het
Nrg4 G T 9: 55,236,512 H87N possibly damaging Het
Olfr1024 T A 2: 85,904,505 Y183F probably damaging Het
Olfr632 T A 7: 103,937,534 H51Q probably benign Het
P3h3 C T 6: 124,845,601 E536K probably damaging Het
Pcdhb11 T C 18: 37,421,718 S34P probably damaging Het
Pik3r1 T C 13: 101,689,406 T71A possibly damaging Het
Plaur T A 7: 24,466,800 C99S possibly damaging Het
Plekha5 G A 6: 140,586,436 G501E probably damaging Het
Plxnd1 C T 6: 115,977,960 V614M probably benign Het
Ppp2r3a T C 9: 101,148,587 D307G possibly damaging Het
Prl3d3 C T 13: 27,157,470 S28F possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Ptk7 C A 17: 46,572,642 Q832H probably damaging Het
Qser1 T C 2: 104,790,090 S126G probably benign Het
Rab3ip A T 10: 116,915,867 C332S probably damaging Het
Raly C A 2: 154,857,366 T30K probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rps6ka1 C T 4: 133,867,224 M159I possibly damaging Het
Rufy3 C T 5: 88,584,309 T57I probably benign Het
Samd4 A G 14: 47,016,631 D184G probably damaging Het
Slc35f3 T C 8: 126,321,094 C58R possibly damaging Het
Smarca4 T C 9: 21,699,877 I1467T probably damaging Het
Spag17 T G 3: 100,065,585 I1371S probably benign Het
Sptan1 T C 2: 30,007,549 L1228P possibly damaging Het
Stk31 C T 6: 49,421,697 A344V probably benign Het
Supt16 A G 14: 52,170,834 W885R probably damaging Het
Tdrd9 T A 12: 112,025,900 probably null Het
Tmod1 A G 4: 46,078,469 probably null Het
Trim75 C A 8: 64,983,442 E119* probably null Het
Wdr6 T C 9: 108,574,911 Y591C probably damaging Het
Wdr86 C T 5: 24,718,283 R137H probably benign Het
Ythdf1 T A 2: 180,911,150 Y424F probably damaging Het
Zfp984 G T 4: 147,756,186 S69R possibly damaging Het
Zyg11a A G 4: 108,181,794 F743L probably damaging Het
Other mutations in Tnfsf13
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1517:Tnfsf13 UTSW 11 69684738 missense possibly damaging 0.91
R1745:Tnfsf13 UTSW 11 69685147 missense probably benign 0.02
R4825:Tnfsf13 UTSW 11 69685249 nonsense probably null
R5613:Tnfsf13 UTSW 11 69683995 splice site probably null
R7027:Tnfsf13 UTSW 11 69685132 critical splice acceptor site probably null
R7778:Tnfsf13 UTSW 11 69685163 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCGTACAATGTCTCCCTGGG -3'
(R):5'- ACAAGAGTGAGTGAGCCCTG -3'

Sequencing Primer
(F):5'- ACGCCTAAGTACTGGTTGC -3'
(R):5'- AGTGAGCCCTGGGGTTTC -3'
Posted On2018-02-28