Incidental Mutation 'R6254:Tdrd9'
ID 506013
Institutional Source Beutler Lab
Gene Symbol Tdrd9
Ensembl Gene ENSMUSG00000054003
Gene Name tudor domain containing 9
Synonyms 4930441E05Rik
MMRRC Submission 044371-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.192) question?
Stock # R6254 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 111937993-112035288 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 111992334 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079009]
AlphaFold Q14BI7
Predicted Effect probably null
Transcript: ENSMUST00000079009
SMART Domains Protein: ENSMUSP00000078022
Gene: ENSMUSG00000054003

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
DEXDc 132 327 5.64e-21 SMART
HELICc 404 502 3.22e-16 SMART
low complexity region 547 561 N/A INTRINSIC
HA2 565 666 1.9e-20 SMART
TUDOR 944 1003 1.52e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191808
Predicted Effect probably benign
Transcript: ENSMUST00000192125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194800
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.4%
Validation Efficiency 100% (82/82)
MGI Phenotype PHENOTYPE: Male homozygous mice are sterile, displaying small testis, arrest of male meiosis and abnormal spermatocyte morphology. Females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A T 12: 113,453,190 (GRCm39) L2F probably damaging Het
Ank2 T A 3: 126,735,453 (GRCm39) probably benign Het
Anpep T G 7: 79,488,981 (GRCm39) D369A probably damaging Het
App T C 16: 84,775,065 (GRCm39) E599G probably damaging Het
Asphd1 C T 7: 126,548,040 (GRCm39) V88I probably benign Het
Atad5 A T 11: 80,018,215 (GRCm39) I1389F probably damaging Het
Blm T C 7: 80,130,090 (GRCm39) N950S probably benign Het
Bsn A T 9: 107,989,065 (GRCm39) M2229K probably damaging Het
Cacna2d2 A G 9: 107,386,415 (GRCm39) M181V probably benign Het
Cadps2 T A 6: 23,329,162 (GRCm39) probably null Het
Cdh1 T A 8: 107,390,430 (GRCm39) V590D probably damaging Het
Cdk5rap2 G A 4: 70,282,269 (GRCm39) T160M probably damaging Het
Cfap97d2 A G 8: 13,756,043 (GRCm39) D26G possibly damaging Het
Cfhr4 A G 1: 139,682,128 (GRCm39) I156T probably damaging Het
Chrna5 A G 9: 54,913,740 (GRCm39) M325V probably benign Het
Clca3a2 A G 3: 144,507,895 (GRCm39) I116T probably benign Het
Cyp2c23 T C 19: 43,993,902 (GRCm39) K488R probably benign Het
Edil3 T A 13: 89,467,848 (GRCm39) I451N probably damaging Het
Exph5 T G 9: 53,284,010 (GRCm39) S364A possibly damaging Het
Fam98c A G 7: 28,853,942 (GRCm39) S209P probably damaging Het
Fat3 G A 9: 15,907,441 (GRCm39) L2854F probably benign Het
Fbxo38 T C 18: 62,638,571 (GRCm39) probably null Het
Fermt2 T C 14: 45,713,516 (GRCm39) D205G probably damaging Het
Fmnl1 G A 11: 103,087,141 (GRCm39) probably benign Het
Fn3k A G 11: 121,325,894 (GRCm39) E27G probably damaging Het
Foxj2 A G 6: 122,815,098 (GRCm39) H378R probably damaging Het
Fubp1 A G 3: 151,938,045 (GRCm39) K140E possibly damaging Het
Gm7694 A T 1: 170,130,103 (GRCm39) C98* probably null Het
Golgb1 T C 16: 36,734,340 (GRCm39) S1196P probably damaging Het
Gpm6a G A 8: 55,500,431 (GRCm39) probably null Het
Hltf T A 3: 20,117,993 (GRCm39) N80K possibly damaging Het
Il1rap G A 16: 26,514,020 (GRCm39) R251H probably benign Het
Ipo7 T A 7: 109,648,267 (GRCm39) D688E probably benign Het
Itgal T A 7: 126,924,375 (GRCm39) N897K probably damaging Het
Itsn2 A G 12: 4,674,982 (GRCm39) probably null Het
Kcnk13 A G 12: 99,931,631 (GRCm39) probably benign Het
Kdm7a A G 6: 39,147,203 (GRCm39) L248P probably damaging Het
Kmt2c T C 5: 25,554,872 (GRCm39) E1254G possibly damaging Het
Ldah G A 12: 8,325,912 (GRCm39) probably benign Het
Lingo1 T A 9: 56,527,371 (GRCm39) D406V possibly damaging Het
Lratd2 A G 15: 60,695,650 (GRCm39) I32T probably damaging Het
Lrriq1 A T 10: 103,051,312 (GRCm39) V480E probably benign Het
Mtcl1 C T 17: 66,665,129 (GRCm39) R1142H probably benign Het
Mtmr3 G A 11: 4,447,381 (GRCm39) Q360* probably null Het
Muc6 T C 7: 141,237,380 (GRCm39) N252S probably benign Het
Naa20 T C 2: 145,745,240 (GRCm39) L4P probably damaging Het
Neb T A 2: 52,112,973 (GRCm39) I4274L probably benign Het
Noa1 A T 5: 77,457,516 (GRCm39) F130I probably benign Het
Nrg4 G T 9: 55,143,796 (GRCm39) H87N possibly damaging Het
Or51ai2 T A 7: 103,586,741 (GRCm39) H51Q probably benign Het
Or5m12 T A 2: 85,734,849 (GRCm39) Y183F probably damaging Het
P3h3 C T 6: 124,822,564 (GRCm39) E536K probably damaging Het
Pcdhb11 T C 18: 37,554,771 (GRCm39) S34P probably damaging Het
Pik3r1 T C 13: 101,825,914 (GRCm39) T71A possibly damaging Het
Plaur T A 7: 24,166,225 (GRCm39) C99S possibly damaging Het
Plekha5 G A 6: 140,532,162 (GRCm39) G501E probably damaging Het
Plxnd1 C T 6: 115,954,921 (GRCm39) V614M probably benign Het
Ppp2r3d T C 9: 101,025,786 (GRCm39) D307G possibly damaging Het
Prl3d3 C T 13: 27,341,453 (GRCm39) S28F possibly damaging Het
Prpf40a T C 2: 53,047,927 (GRCm39) M197V probably benign Het
Ptk7 C A 17: 46,883,568 (GRCm39) Q832H probably damaging Het
Qser1 T C 2: 104,620,435 (GRCm39) S126G probably benign Het
Rab3ip A T 10: 116,751,772 (GRCm39) C332S probably damaging Het
Raly C A 2: 154,699,286 (GRCm39) T30K probably damaging Het
Rbp2 G T 9: 98,372,700 (GRCm39) S13I probably benign Het
Rps6ka1 C T 4: 133,594,535 (GRCm39) M159I possibly damaging Het
Rufy3 C T 5: 88,732,168 (GRCm39) T57I probably benign Het
Samd4 A G 14: 47,254,088 (GRCm39) D184G probably damaging Het
Slc35f3 T C 8: 127,047,833 (GRCm39) C58R possibly damaging Het
Smarca4 T C 9: 21,611,173 (GRCm39) I1467T probably damaging Het
Spag17 T G 3: 99,972,901 (GRCm39) I1371S probably benign Het
Sptan1 T C 2: 29,897,561 (GRCm39) L1228P possibly damaging Het
Stk31 C T 6: 49,398,631 (GRCm39) A344V probably benign Het
Supt16 A G 14: 52,408,291 (GRCm39) W885R probably damaging Het
Tmod1 A G 4: 46,078,469 (GRCm39) probably null Het
Tnfsf13 A C 11: 69,575,309 (GRCm39) probably null Het
Trim75 C A 8: 65,436,094 (GRCm39) E119* probably null Het
Wdr6 T C 9: 108,452,110 (GRCm39) Y591C probably damaging Het
Wdr86 C T 5: 24,923,281 (GRCm39) R137H probably benign Het
Ythdf1 T A 2: 180,552,943 (GRCm39) Y424F probably damaging Het
Zfp984 G T 4: 147,840,643 (GRCm39) S69R possibly damaging Het
Zyg11a A G 4: 108,038,991 (GRCm39) F743L probably damaging Het
Other mutations in Tdrd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Tdrd9 APN 12 112,006,868 (GRCm39) missense probably damaging 1.00
IGL01373:Tdrd9 APN 12 112,006,868 (GRCm39) missense probably damaging 1.00
IGL01542:Tdrd9 APN 12 112,013,423 (GRCm39) missense possibly damaging 0.94
IGL02967:Tdrd9 APN 12 111,958,922 (GRCm39) missense possibly damaging 0.50
IGL03063:Tdrd9 APN 12 112,010,733 (GRCm39) missense probably benign 0.00
IGL03107:Tdrd9 APN 12 112,009,274 (GRCm39) missense probably damaging 0.98
R0433:Tdrd9 UTSW 12 111,992,015 (GRCm39) nonsense probably null
R0453:Tdrd9 UTSW 12 112,034,673 (GRCm39) missense probably benign
R0655:Tdrd9 UTSW 12 112,006,899 (GRCm39) missense probably damaging 1.00
R0666:Tdrd9 UTSW 12 111,974,014 (GRCm39) intron probably benign
R1073:Tdrd9 UTSW 12 111,989,693 (GRCm39) missense probably damaging 1.00
R1280:Tdrd9 UTSW 12 112,005,842 (GRCm39) missense probably damaging 1.00
R1386:Tdrd9 UTSW 12 112,011,238 (GRCm39) missense probably benign 0.21
R1521:Tdrd9 UTSW 12 112,002,844 (GRCm39) missense probably damaging 1.00
R1601:Tdrd9 UTSW 12 111,989,687 (GRCm39) nonsense probably null
R1651:Tdrd9 UTSW 12 111,991,140 (GRCm39) missense probably damaging 0.97
R1715:Tdrd9 UTSW 12 112,002,873 (GRCm39) missense possibly damaging 0.62
R1854:Tdrd9 UTSW 12 112,011,246 (GRCm39) missense probably damaging 1.00
R1905:Tdrd9 UTSW 12 112,030,061 (GRCm39) splice site probably benign
R2386:Tdrd9 UTSW 12 111,982,334 (GRCm39) missense probably damaging 1.00
R2863:Tdrd9 UTSW 12 111,997,695 (GRCm39) missense probably benign
R2915:Tdrd9 UTSW 12 112,006,895 (GRCm39) missense probably damaging 1.00
R2958:Tdrd9 UTSW 12 112,008,106 (GRCm39) missense probably damaging 0.97
R4033:Tdrd9 UTSW 12 111,958,973 (GRCm39) missense possibly damaging 0.58
R4087:Tdrd9 UTSW 12 111,979,920 (GRCm39) nonsense probably null
R4237:Tdrd9 UTSW 12 112,034,059 (GRCm39) nonsense probably null
R4482:Tdrd9 UTSW 12 111,980,935 (GRCm39) critical splice donor site probably null
R4501:Tdrd9 UTSW 12 112,009,243 (GRCm39) missense probably benign 0.00
R4502:Tdrd9 UTSW 12 111,960,259 (GRCm39) missense probably damaging 1.00
R4715:Tdrd9 UTSW 12 112,008,123 (GRCm39) missense probably benign 0.00
R4803:Tdrd9 UTSW 12 111,963,269 (GRCm39) nonsense probably null
R5218:Tdrd9 UTSW 12 112,029,909 (GRCm39) intron probably benign
R5275:Tdrd9 UTSW 12 112,018,346 (GRCm39) nonsense probably null
R5295:Tdrd9 UTSW 12 112,018,346 (GRCm39) nonsense probably null
R5301:Tdrd9 UTSW 12 112,002,963 (GRCm39) critical splice donor site probably null
R5339:Tdrd9 UTSW 12 111,993,556 (GRCm39) missense probably damaging 1.00
R5500:Tdrd9 UTSW 12 111,989,702 (GRCm39) missense probably benign 0.02
R5573:Tdrd9 UTSW 12 111,964,336 (GRCm39) splice site probably null
R5590:Tdrd9 UTSW 12 112,018,414 (GRCm39) missense probably benign 0.01
R5891:Tdrd9 UTSW 12 112,009,153 (GRCm39) missense probably damaging 1.00
R6056:Tdrd9 UTSW 12 111,951,475 (GRCm39) missense probably damaging 1.00
R6057:Tdrd9 UTSW 12 111,979,720 (GRCm39) missense possibly damaging 0.85
R6125:Tdrd9 UTSW 12 112,034,632 (GRCm39) missense possibly damaging 0.89
R6335:Tdrd9 UTSW 12 112,008,186 (GRCm39) critical splice donor site probably null
R6345:Tdrd9 UTSW 12 112,001,042 (GRCm39) missense probably damaging 0.99
R6792:Tdrd9 UTSW 12 111,993,547 (GRCm39) missense probably benign 0.01
R6956:Tdrd9 UTSW 12 112,002,788 (GRCm39) splice site probably benign
R6987:Tdrd9 UTSW 12 111,992,027 (GRCm39) missense possibly damaging 0.82
R7090:Tdrd9 UTSW 12 111,958,904 (GRCm39) missense probably benign
R7158:Tdrd9 UTSW 12 112,002,800 (GRCm39) missense probably benign 0.08
R7220:Tdrd9 UTSW 12 111,980,888 (GRCm39) missense probably damaging 1.00
R7478:Tdrd9 UTSW 12 111,951,476 (GRCm39) missense probably damaging 1.00
R7489:Tdrd9 UTSW 12 112,034,071 (GRCm39) missense probably benign 0.00
R7751:Tdrd9 UTSW 12 111,958,982 (GRCm39) missense probably benign 0.09
R7809:Tdrd9 UTSW 12 111,999,155 (GRCm39) missense probably damaging 0.99
R7844:Tdrd9 UTSW 12 111,964,386 (GRCm39) missense possibly damaging 0.63
R7854:Tdrd9 UTSW 12 112,013,395 (GRCm39) missense probably benign 0.00
R7903:Tdrd9 UTSW 12 112,018,410 (GRCm39) missense possibly damaging 0.95
R7938:Tdrd9 UTSW 12 111,997,649 (GRCm39) missense possibly damaging 0.86
R8018:Tdrd9 UTSW 12 112,010,822 (GRCm39) missense probably damaging 0.99
R8018:Tdrd9 UTSW 12 111,999,180 (GRCm39) missense probably benign 0.12
R8090:Tdrd9 UTSW 12 111,982,369 (GRCm39) missense probably damaging 1.00
R8157:Tdrd9 UTSW 12 111,951,500 (GRCm39) missense probably benign 0.44
R8198:Tdrd9 UTSW 12 112,006,863 (GRCm39) missense probably damaging 1.00
R8203:Tdrd9 UTSW 12 111,992,064 (GRCm39) missense probably damaging 1.00
R8512:Tdrd9 UTSW 12 112,012,627 (GRCm39) missense probably benign
R8721:Tdrd9 UTSW 12 112,002,889 (GRCm39) missense probably damaging 1.00
R8889:Tdrd9 UTSW 12 111,979,718 (GRCm39) missense probably benign 0.07
R8892:Tdrd9 UTSW 12 111,979,718 (GRCm39) missense probably benign 0.07
R9276:Tdrd9 UTSW 12 111,980,935 (GRCm39) critical splice donor site probably null
R9459:Tdrd9 UTSW 12 111,992,007 (GRCm39) missense probably damaging 1.00
R9484:Tdrd9 UTSW 12 112,012,684 (GRCm39) missense probably damaging 0.97
R9657:Tdrd9 UTSW 12 112,002,824 (GRCm39) missense possibly damaging 0.50
R9745:Tdrd9 UTSW 12 112,009,130 (GRCm39) missense probably damaging 0.99
X0018:Tdrd9 UTSW 12 112,005,763 (GRCm39) missense probably benign 0.24
Z1177:Tdrd9 UTSW 12 111,982,355 (GRCm39) missense probably damaging 1.00
Z1177:Tdrd9 UTSW 12 111,960,325 (GRCm39) missense probably damaging 0.96
Z1177:Tdrd9 UTSW 12 111,938,088 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCATCATAGGTGAGTGGGACCG -3'
(R):5'- TCAGCCTCAGGAAATACCGC -3'

Sequencing Primer
(F):5'- ACAGCTGCTGTGGGGACAG -3'
(R):5'- TCCTGTGAGAGCCACCAGAAG -3'
Posted On 2018-02-28