Mutagenetix > Incidental Mutation

Incidental Mutation 'R6254:Supt16'

506020

Institutional Source

Beutler Lab

Gene Symbol

Supt16

Ensembl Gene

ENSMUSG00000035726

Gene Name

suppressor of Ty 16

Synonyms

Supt16h, Spt16, Fact140, Cdc68

MMRRC Submission

044371-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.967) question?

Stock #

R6254 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

52160414-52197416 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 52170834 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 885 (W885R)

Ref Sequence

ENSEMBL: ENSMUSP00000042283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046709]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000046709
AA Change: W885R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: W885R

Domain	Start	End	E-Value	Type
FACT-Spt16_Nlob	5	168	2.95e-87	SMART
Pfam:Peptidase_M24	181	411	2.9e-35	PFAM
low complexity region	435	449	N/A	INTRINSIC
coiled coil region	462	493	N/A	INTRINSIC
SPT16	529	689	3.38e-96	SMART
Rtt106	806	896	1.61e-38	SMART
low complexity region	926	946	N/A	INTRINSIC
low complexity region	951	988	N/A	INTRINSIC
coiled coil region	994	1023	N/A	INTRINSIC

Meta Mutation Damage Score

0.9746

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.4%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932443I19Rik	A	G	8: 13,706,043	D26G	possibly damaging	Het
Adam6b	A	T	12: 113,489,570	L2F	probably damaging	Het
Ank2	T	A	3: 126,941,804		probably benign	Het
Anpep	T	G	7: 79,839,233	D369A	probably damaging	Het
App	T	C	16: 84,978,177	E599G	probably damaging	Het
Asphd1	C	T	7: 126,948,868	V88I	probably benign	Het
Atad5	A	T	11: 80,127,389	I1389F	probably damaging	Het
Blm	T	C	7: 80,480,342	N950S	probably benign	Het
Bsn	A	T	9: 108,111,866	M2229K	probably damaging	Het
Cacna2d2	A	G	9: 107,509,216	M181V	probably benign	Het
Cadps2	T	A	6: 23,329,163		probably null	Het
Cdh1	T	A	8: 106,663,798	V590D	probably damaging	Het
Cdk5rap2	G	A	4: 70,364,032	T160M	probably damaging	Het
Chrna5	A	G	9: 55,006,456	M325V	probably benign	Het
Clca3a2	A	G	3: 144,802,134	I116T	probably benign	Het
Cyp2c23	T	C	19: 44,005,463	K488R	probably benign	Het
Edil3	T	A	13: 89,319,729	I451N	probably damaging	Het
Exph5	T	G	9: 53,372,710	S364A	possibly damaging	Het
Fam84b	A	G	15: 60,823,801	I32T	probably damaging	Het
Fam98c	A	G	7: 29,154,517	S209P	probably damaging	Het
Fat3	G	A	9: 15,996,145	L2854F	probably benign	Het
Fbxo38	T	C	18: 62,505,500		probably null	Het
Fermt2	T	C	14: 45,476,059	D205G	probably damaging	Het
Fmnl1	G	A	11: 103,196,315		probably benign	Het
Fn3k	A	G	11: 121,435,068	E27G	probably damaging	Het
Foxj2	A	G	6: 122,838,139	H378R	probably damaging	Het
Fubp1	A	G	3: 152,232,408	K140E	possibly damaging	Het
Gm4788	A	G	1: 139,754,390	I156T	probably damaging	Het
Gm7694	A	T	1: 170,302,534	C98*	probably null	Het
Golgb1	T	C	16: 36,913,978	S1196P	probably damaging	Het
Gpm6a	G	A	8: 55,047,396		probably null	Het
Hltf	T	A	3: 20,063,829	N80K	possibly damaging	Het
Il1rap	G	A	16: 26,695,270	R251H	probably benign	Het
Ipo7	T	A	7: 110,049,060	D688E	probably benign	Het
Itgal	T	A	7: 127,325,203	N897K	probably damaging	Het
Itsn2	A	G	12: 4,624,982		probably null	Het
Kcnk13	A	G	12: 99,965,372		probably benign	Het
Kdm7a	A	G	6: 39,170,269	L248P	probably damaging	Het
Kmt2c	T	C	5: 25,349,874	E1254G	possibly damaging	Het
Ldah	G	A	12: 8,275,912		probably benign	Het
Lingo1	T	A	9: 56,620,087	D406V	possibly damaging	Het
Lrriq1	A	T	10: 103,215,451	V480E	probably benign	Het
Mtcl1	C	T	17: 66,358,134	R1142H	probably benign	Het
Mtmr3	G	A	11: 4,497,381	Q360*	probably null	Het
Muc6	T	C	7: 141,651,115	N252S	probably benign	Het
Naa20	T	C	2: 145,903,320	L4P	probably damaging	Het
Neb	T	A	2: 52,222,961	I4274L	probably benign	Het
Noa1	A	T	5: 77,309,669	F130I	probably benign	Het
Nrg4	G	T	9: 55,236,512	H87N	possibly damaging	Het
Olfr1024	T	A	2: 85,904,505	Y183F	probably damaging	Het
Olfr632	T	A	7: 103,937,534	H51Q	probably benign	Het
P3h3	C	T	6: 124,845,601	E536K	probably damaging	Het
Pcdhb11	T	C	18: 37,421,718	S34P	probably damaging	Het
Pik3r1	T	C	13: 101,689,406	T71A	possibly damaging	Het
Plaur	T	A	7: 24,466,800	C99S	possibly damaging	Het
Plekha5	G	A	6: 140,586,436	G501E	probably damaging	Het
Plxnd1	C	T	6: 115,977,960	V614M	probably benign	Het
Ppp2r3a	T	C	9: 101,148,587	D307G	possibly damaging	Het
Prl3d3	C	T	13: 27,157,470	S28F	possibly damaging	Het
Prpf40a	T	C	2: 53,157,915	M197V	probably benign	Het
Ptk7	C	A	17: 46,572,642	Q832H	probably damaging	Het
Qser1	T	C	2: 104,790,090	S126G	probably benign	Het
Rab3ip	A	T	10: 116,915,867	C332S	probably damaging	Het
Raly	C	A	2: 154,857,366	T30K	probably damaging	Het
Rbp2	G	T	9: 98,490,647	S13I	probably benign	Het
Rps6ka1	C	T	4: 133,867,224	M159I	possibly damaging	Het
Rufy3	C	T	5: 88,584,309	T57I	probably benign	Het
Samd4	A	G	14: 47,016,631	D184G	probably damaging	Het
Slc35f3	T	C	8: 126,321,094	C58R	possibly damaging	Het
Smarca4	T	C	9: 21,699,877	I1467T	probably damaging	Het
Spag17	T	G	3: 100,065,585	I1371S	probably benign	Het
Sptan1	T	C	2: 30,007,549	L1228P	possibly damaging	Het
Stk31	C	T	6: 49,421,697	A344V	probably benign	Het
Tdrd9	T	A	12: 112,025,900		probably null	Het
Tmod1	A	G	4: 46,078,469		probably null	Het
Tnfsf13	A	C	11: 69,684,483		probably null	Het
Trim75	C	A	8: 64,983,442	E119*	probably null	Het
Wdr6	T	C	9: 108,574,911	Y591C	probably damaging	Het
Wdr86	C	T	5: 24,718,283	R137H	probably benign	Het
Ythdf1	T	A	2: 180,911,150	Y424F	probably damaging	Het
Zfp984	G	T	4: 147,756,186	S69R	possibly damaging	Het
Zyg11a	A	G	4: 108,181,794	F743L	probably damaging	Het

Other mutations in Supt16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Supt16	APN	14	52161798	missense	possibly damaging	0.72
IGL00985:Supt16	APN	14	52161691	missense	possibly damaging	0.53
IGL01160:Supt16	APN	14	52183132	missense	probably benign
IGL01328:Supt16	APN	14	52177032	missense	probably benign	0.20
IGL01329:Supt16	APN	14	52177032	missense	probably benign	0.20
IGL01413:Supt16	APN	14	52177032	missense	probably benign	0.20
IGL01414:Supt16	APN	14	52177032	missense	probably benign	0.20
IGL01535:Supt16	APN	14	52177190	missense	probably damaging	0.99
IGL01765:Supt16	APN	14	52180223	missense	probably damaging	0.98
IGL01976:Supt16	APN	14	52182307	missense	possibly damaging	0.70
IGL02422:Supt16	APN	14	52179543	missense	possibly damaging	0.85
IGL02449:Supt16	APN	14	52173806	missense	possibly damaging	0.92
IGL02516:Supt16	APN	14	52183964	missense	possibly damaging	0.57
IGL02831:Supt16	APN	14	52170878	missense	possibly damaging	0.70
IGL03112:Supt16	APN	14	52176398	missense	probably damaging	0.98
IGL03406:Supt16	APN	14	52178141	missense	possibly damaging	0.92
R7336_Supt16_529	UTSW	14	52171491	missense	possibly damaging	0.93
watercolor	UTSW	14	52170881	missense	probably damaging	0.96
R0332:Supt16	UTSW	14	52181157	missense	probably damaging	0.99
R0385:Supt16	UTSW	14	52176718	missense	probably benign	0.01
R0389:Supt16	UTSW	14	52174113	missense	probably damaging	0.98
R0422:Supt16	UTSW	14	52183996	missense	probably benign	0.26
R1101:Supt16	UTSW	14	52171439	missense	probably null	0.81
R1212:Supt16	UTSW	14	52174124	nonsense	probably null
R1487:Supt16	UTSW	14	52176608	critical splice donor site	probably null
R1494:Supt16	UTSW	14	52172459	missense	probably benign	0.01
R1566:Supt16	UTSW	14	52176655	missense	probably damaging	0.99
R1652:Supt16	UTSW	14	52177180	missense	probably benign	0.34
R1913:Supt16	UTSW	14	52178135	missense	possibly damaging	0.84
R2220:Supt16	UTSW	14	52172144	nonsense	probably null
R2344:Supt16	UTSW	14	52178118	missense	probably benign	0.00
R3430:Supt16	UTSW	14	52175359	missense	probably benign	0.05
R3746:Supt16	UTSW	14	52180139	missense	probably damaging	0.99
R3749:Supt16	UTSW	14	52180139	missense	probably damaging	0.99
R4010:Supt16	UTSW	14	52164441	missense	probably damaging	1.00
R4108:Supt16	UTSW	14	52162731	missense	probably damaging	1.00
R4109:Supt16	UTSW	14	52162731	missense	probably damaging	1.00
R4597:Supt16	UTSW	14	52173589	missense	probably damaging	1.00
R5117:Supt16	UTSW	14	52183092	missense	probably damaging	1.00
R5309:Supt16	UTSW	14	52162698	missense	probably damaging	1.00
R5695:Supt16	UTSW	14	52174144	splice site	probably null
R5895:Supt16	UTSW	14	52164522	missense	probably benign	0.17
R5941:Supt16	UTSW	14	52182196	missense	probably benign
R5993:Supt16	UTSW	14	52178334	missense	probably damaging	1.00
R6197:Supt16	UTSW	14	52170881	missense	probably damaging	0.96
R6381:Supt16	UTSW	14	52179546	missense	probably benign	0.02
R6667:Supt16	UTSW	14	52172063	missense	probably damaging	1.00
R7000:Supt16	UTSW	14	52171450	missense	probably damaging	0.97
R7063:Supt16	UTSW	14	52172048	missense	possibly damaging	0.92
R7276:Supt16	UTSW	14	52177001	missense	probably benign
R7336:Supt16	UTSW	14	52171491	missense	possibly damaging	0.93
R7344:Supt16	UTSW	14	52173571	missense	probably damaging	0.98
R7384:Supt16	UTSW	14	52181162	missense	probably damaging	0.99
R7411:Supt16	UTSW	14	52178051	missense	probably damaging	1.00
R7586:Supt16	UTSW	14	52173556	missense	probably damaging	0.97
R7633:Supt16	UTSW	14	52197099	missense	probably benign	0.38
R8024:Supt16	UTSW	14	52170875	missense	probably damaging	0.96
R8197:Supt16	UTSW	14	52174085	missense	possibly damaging	0.95
R8201:Supt16	UTSW	14	52170990	missense	probably damaging	1.00
R8285:Supt16	UTSW	14	52181083	missense	possibly damaging	0.95
R8508:Supt16	UTSW	14	52181589	missense	probably damaging	1.00
R8531:Supt16	UTSW	14	52172563	missense	probably damaging	0.98
R8797:Supt16	UTSW	14	52172503	missense	probably damaging	0.99
R8872:Supt16	UTSW	14	52174087	missense	probably benign	0.01
R9048:Supt16	UTSW	14	52181056	missense	probably damaging	1.00
Z1177:Supt16	UTSW	14	52163285	missense	possibly damaging	0.63
Z1177:Supt16	UTSW	14	52181537	missense	probably null	0.21

Predicted Primers

PCR Primer
(F):5'- AAAGCAGAAGCCAACTGTTTAG -3'
(R):5'- GTTTTGACAGCCACCCTTTG -3'

Sequencing Primer
(F):5'- CAGAAGCCAACTGTTTAGGAGAATG -3'
(R):5'- GTCCAGTTTCACCTGAAG -3'

Posted On

2018-02-28