Incidental Mutation 'R6254:App'
ID506024
Institutional Source Beutler Lab
Gene Symbol App
Ensembl Gene ENSMUSG00000022892
Gene Nameamyloid beta (A4) precursor protein
SynonymsAdap, Abeta, protease nexin II, E030013M08Rik, betaAPP, appican, Cvap
MMRRC Submission 044371-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.637) question?
Stock #R6254 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location84949685-85173766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84978177 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 599 (E599G)
Ref Sequence ENSEMBL: ENSMUSP00000154061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005406] [ENSMUST00000226232] [ENSMUST00000226801] [ENSMUST00000227021] [ENSMUST00000227723] [ENSMUST00000227737]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005406
AA Change: E524G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000005406
Gene: ENSMUSG00000022892
AA Change: E524G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
A4_EXTRA 24 188 5.33e-129 SMART
low complexity region 190 208 N/A INTRINSIC
Pfam:APP_E2 291 473 2.5e-77 PFAM
Pfam:Beta-APP 600 638 3.4e-28 PFAM
Pfam:APP_amyloid 641 691 8.6e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226232
AA Change: E580G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000226801
AA Change: E599G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000227021
AA Change: E580G
Predicted Effect probably damaging
Transcript: ENSMUST00000227723
AA Change: E599G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000227737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228375
Meta Mutation Damage Score 0.1616 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.4%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor and transmembrane precursor protein that is cleaved by secretases to form a number of peptides. Some of these peptides are secreted and can bind to the acetyltransferase complex APBB1/TIP60 to promote transcriptional activation, while others form the protein basis of the amyloid plaques found in the brains of patients with Alzheimer disease. In addition, two of the peptides are antimicrobial peptides, having been shown to have bacteriocidal and antifungal activities. Mutations in this gene have been implicated in autosomal dominant Alzheimer disease and cerebroarterial amyloidosis (cerebral amyloid angiopathy). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit reduced body weight, brain weight, size of forebrain commissures, locomotor activity, forelimb grip strength, and spatial learning scores. Many mice also exhibit agenesis of the corpus callosum, and extensive reactive gliosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik A G 8: 13,706,043 D26G possibly damaging Het
Adam6b A T 12: 113,489,570 L2F probably damaging Het
Ank2 T A 3: 126,941,804 probably benign Het
Anpep T G 7: 79,839,233 D369A probably damaging Het
Asphd1 C T 7: 126,948,868 V88I probably benign Het
Atad5 A T 11: 80,127,389 I1389F probably damaging Het
Blm T C 7: 80,480,342 N950S probably benign Het
Bsn A T 9: 108,111,866 M2229K probably damaging Het
Cacna2d2 A G 9: 107,509,216 M181V probably benign Het
Cadps2 T A 6: 23,329,163 probably null Het
Cdh1 T A 8: 106,663,798 V590D probably damaging Het
Cdk5rap2 G A 4: 70,364,032 T160M probably damaging Het
Chrna5 A G 9: 55,006,456 M325V probably benign Het
Clca3a2 A G 3: 144,802,134 I116T probably benign Het
Cyp2c23 T C 19: 44,005,463 K488R probably benign Het
Edil3 T A 13: 89,319,729 I451N probably damaging Het
Exph5 T G 9: 53,372,710 S364A possibly damaging Het
Fam84b A G 15: 60,823,801 I32T probably damaging Het
Fam98c A G 7: 29,154,517 S209P probably damaging Het
Fat3 G A 9: 15,996,145 L2854F probably benign Het
Fbxo38 T C 18: 62,505,500 probably null Het
Fermt2 T C 14: 45,476,059 D205G probably damaging Het
Fmnl1 G A 11: 103,196,315 probably benign Het
Fn3k A G 11: 121,435,068 E27G probably damaging Het
Foxj2 A G 6: 122,838,139 H378R probably damaging Het
Fubp1 A G 3: 152,232,408 K140E possibly damaging Het
Gm4788 A G 1: 139,754,390 I156T probably damaging Het
Gm7694 A T 1: 170,302,534 C98* probably null Het
Golgb1 T C 16: 36,913,978 S1196P probably damaging Het
Gpm6a G A 8: 55,047,396 probably null Het
Hltf T A 3: 20,063,829 N80K possibly damaging Het
Il1rap G A 16: 26,695,270 R251H probably benign Het
Ipo7 T A 7: 110,049,060 D688E probably benign Het
Itgal T A 7: 127,325,203 N897K probably damaging Het
Itsn2 A G 12: 4,624,982 probably null Het
Kcnk13 A G 12: 99,965,372 probably benign Het
Kdm7a A G 6: 39,170,269 L248P probably damaging Het
Kmt2c T C 5: 25,349,874 E1254G possibly damaging Het
Ldah G A 12: 8,275,912 probably benign Het
Lingo1 T A 9: 56,620,087 D406V possibly damaging Het
Lrriq1 A T 10: 103,215,451 V480E probably benign Het
Mtcl1 C T 17: 66,358,134 R1142H probably benign Het
Mtmr3 G A 11: 4,497,381 Q360* probably null Het
Muc6 T C 7: 141,651,115 N252S probably benign Het
Naa20 T C 2: 145,903,320 L4P probably damaging Het
Neb T A 2: 52,222,961 I4274L probably benign Het
Noa1 A T 5: 77,309,669 F130I probably benign Het
Nrg4 G T 9: 55,236,512 H87N possibly damaging Het
Olfr1024 T A 2: 85,904,505 Y183F probably damaging Het
Olfr632 T A 7: 103,937,534 H51Q probably benign Het
P3h3 C T 6: 124,845,601 E536K probably damaging Het
Pcdhb11 T C 18: 37,421,718 S34P probably damaging Het
Pik3r1 T C 13: 101,689,406 T71A possibly damaging Het
Plaur T A 7: 24,466,800 C99S possibly damaging Het
Plekha5 G A 6: 140,586,436 G501E probably damaging Het
Plxnd1 C T 6: 115,977,960 V614M probably benign Het
Ppp2r3a T C 9: 101,148,587 D307G possibly damaging Het
Prl3d3 C T 13: 27,157,470 S28F possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Ptk7 C A 17: 46,572,642 Q832H probably damaging Het
Qser1 T C 2: 104,790,090 S126G probably benign Het
Rab3ip A T 10: 116,915,867 C332S probably damaging Het
Raly C A 2: 154,857,366 T30K probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rps6ka1 C T 4: 133,867,224 M159I possibly damaging Het
Rufy3 C T 5: 88,584,309 T57I probably benign Het
Samd4 A G 14: 47,016,631 D184G probably damaging Het
Slc35f3 T C 8: 126,321,094 C58R possibly damaging Het
Smarca4 T C 9: 21,699,877 I1467T probably damaging Het
Spag17 T G 3: 100,065,585 I1371S probably benign Het
Sptan1 T C 2: 30,007,549 L1228P possibly damaging Het
Stk31 C T 6: 49,421,697 A344V probably benign Het
Supt16 A G 14: 52,170,834 W885R probably damaging Het
Tdrd9 T A 12: 112,025,900 probably null Het
Tmod1 A G 4: 46,078,469 probably null Het
Tnfsf13 A C 11: 69,684,483 probably null Het
Trim75 C A 8: 64,983,442 E119* probably null Het
Wdr6 T C 9: 108,574,911 Y591C probably damaging Het
Wdr86 C T 5: 24,718,283 R137H probably benign Het
Ythdf1 T A 2: 180,911,150 Y424F probably damaging Het
Zfp984 G T 4: 147,756,186 S69R possibly damaging Het
Zyg11a A G 4: 108,181,794 F743L probably damaging Het
Other mutations in App
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:App APN 16 84965711 missense probably damaging 0.99
IGL01457:App APN 16 85103239 missense probably damaging 1.00
IGL02016:App APN 16 85056521 missense unknown
IGL02135:App APN 16 85079838 critical splice donor site probably null
IGL02338:App APN 16 85173519 missense probably benign 0.01
IGL02377:App APN 16 85082831 missense probably benign 0.07
IGL02516:App APN 16 84955417 missense probably damaging 1.00
IGL02565:App APN 16 85025420 splice site probably null
IGL03179:App APN 16 85082847 missense probably damaging 1.00
LCD18:App UTSW 16 85025412 splice site probably benign
R0349:App UTSW 16 85013680 missense probably damaging 1.00
R0440:App UTSW 16 85056414 nonsense probably null
R0515:App UTSW 16 85103344 splice site probably benign
R0730:App UTSW 16 85079952 missense probably damaging 0.98
R1609:App UTSW 16 85079949 missense probably damaging 0.97
R1703:App UTSW 16 84965768 missense probably damaging 1.00
R2516:App UTSW 16 84978229 missense probably damaging 0.97
R4366:App UTSW 16 85056433 missense unknown
R4735:App UTSW 16 85103314 missense probably damaging 0.99
R4849:App UTSW 16 85056434 missense unknown
R4851:App UTSW 16 85056434 missense unknown
R6489:App UTSW 16 85056520 missense unknown
R6796:App UTSW 16 85120567 missense probably damaging 0.98
R7132:App UTSW 16 85056482 missense unknown
R7194:App UTSW 16 85025431 missense probably benign 0.40
R7456:App UTSW 16 85173560
R7528:App UTSW 16 84978258 missense possibly damaging 0.89
R7594:App UTSW 16 85080002 missense unknown
R7699:App UTSW 16 85040309 critical splice acceptor site probably null
R7700:App UTSW 16 85040309 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACCAGGTCCTTCTCTCAAAAG -3'
(R):5'- CACACGGCATGTAGTCAGTAG -3'

Sequencing Primer
(F):5'- GCAACTGTTACCATGGGGAC -3'
(R):5'- TCAGTAGGAATGGCCGCTG -3'
Posted On2018-02-28