Mutagenetix > Incidental Mutations

Incidental Mutation 'R6254:App'

506024

Institutional Source

Beutler Lab

Gene Symbol

App

Ensembl Gene

ENSMUSG00000022892

Gene Name

amyloid beta (A4) precursor protein

Synonyms

Adap, Abeta, protease nexin II, E030013M08Rik, betaAPP, appican, Cvap

MMRRC Submission

044371-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.551) question?

Stock #

R6254 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84949685-85173766 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84978177 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 599 (E599G)

Ref Sequence

ENSEMBL: ENSMUSP00000154061 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005406] [ENSMUST00000226232] [ENSMUST00000226801] [ENSMUST00000227021] [ENSMUST00000227723] [ENSMUST00000227737]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000005406
AA Change: E524G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000005406
Gene: ENSMUSG00000022892
AA Change: E524G

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
A4_EXTRA	24	188	5.33e-129	SMART
low complexity region	190	208	N/A	INTRINSIC
Pfam:APP_E2	291	473	2.5e-77	PFAM
Pfam:Beta-APP	600	638	3.4e-28	PFAM
Pfam:APP_amyloid	641	691	8.6e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000226232
AA Change: E580G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

probably damaging
Transcript: ENSMUST00000226801
AA Change: E599G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

unknown
Transcript: ENSMUST00000227021
AA Change: E580G

Predicted Effect

probably damaging
Transcript: ENSMUST00000227723
AA Change: E599G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000227737

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227835

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228375

Meta Mutation Damage Score

0.1616

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.4%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor and transmembrane precursor protein that is cleaved by secretases to form a number of peptides. Some of these peptides are secreted and can bind to the acetyltransferase complex APBB1/TIP60 to promote transcriptional activation, while others form the protein basis of the amyloid plaques found in the brains of patients with Alzheimer disease. In addition, two of the peptides are antimicrobial peptides, having been shown to have bacteriocidal and antifungal activities. Mutations in this gene have been implicated in autosomal dominant Alzheimer disease and cerebroarterial amyloidosis (cerebral amyloid angiopathy). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit reduced body weight, brain weight, size of forebrain commissures, locomotor activity, forelimb grip strength, and spatial learning scores. Many mice also exhibit agenesis of the corpus callosum, and extensive reactive gliosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932443I19Rik	A	G	8: 13,706,043	D26G	possibly damaging	Het
Adam6b	A	T	12: 113,489,570	L2F	probably damaging	Het
Ank2	T	A	3: 126,941,804		probably benign	Het
Anpep	T	G	7: 79,839,233	D369A	probably damaging	Het
Asphd1	C	T	7: 126,948,868	V88I	probably benign	Het
Atad5	A	T	11: 80,127,389	I1389F	probably damaging	Het
Blm	T	C	7: 80,480,342	N950S	probably benign	Het
Bsn	A	T	9: 108,111,866	M2229K	probably damaging	Het
Cacna2d2	A	G	9: 107,509,216	M181V	probably benign	Het
Cadps2	T	A	6: 23,329,163		probably null	Het
Cdh1	T	A	8: 106,663,798	V590D	probably damaging	Het
Cdk5rap2	G	A	4: 70,364,032	T160M	probably damaging	Het
Chrna5	A	G	9: 55,006,456	M325V	probably benign	Het
Clca3a2	A	G	3: 144,802,134	I116T	probably benign	Het
Cyp2c23	T	C	19: 44,005,463	K488R	probably benign	Het
Edil3	T	A	13: 89,319,729	I451N	probably damaging	Het
Exph5	T	G	9: 53,372,710	S364A	possibly damaging	Het
Fam84b	A	G	15: 60,823,801	I32T	probably damaging	Het
Fam98c	A	G	7: 29,154,517	S209P	probably damaging	Het
Fat3	G	A	9: 15,996,145	L2854F	probably benign	Het
Fbxo38	T	C	18: 62,505,500		probably null	Het
Fermt2	T	C	14: 45,476,059	D205G	probably damaging	Het
Fmnl1	G	A	11: 103,196,315		probably benign	Het
Fn3k	A	G	11: 121,435,068	E27G	probably damaging	Het
Foxj2	A	G	6: 122,838,139	H378R	probably damaging	Het
Fubp1	A	G	3: 152,232,408	K140E	possibly damaging	Het
Gm4788	A	G	1: 139,754,390	I156T	probably damaging	Het
Gm7694	A	T	1: 170,302,534	C98*	probably null	Het
Golgb1	T	C	16: 36,913,978	S1196P	probably damaging	Het
Gpm6a	G	A	8: 55,047,396		probably null	Het
Hltf	T	A	3: 20,063,829	N80K	possibly damaging	Het
Il1rap	G	A	16: 26,695,270	R251H	probably benign	Het
Ipo7	T	A	7: 110,049,060	D688E	probably benign	Het
Itgal	T	A	7: 127,325,203	N897K	probably damaging	Het
Itsn2	A	G	12: 4,624,982		probably null	Het
Kcnk13	A	G	12: 99,965,372		probably benign	Het
Kdm7a	A	G	6: 39,170,269	L248P	probably damaging	Het
Kmt2c	T	C	5: 25,349,874	E1254G	possibly damaging	Het
Ldah	G	A	12: 8,275,912		probably benign	Het
Lingo1	T	A	9: 56,620,087	D406V	possibly damaging	Het
Lrriq1	A	T	10: 103,215,451	V480E	probably benign	Het
Mtcl1	C	T	17: 66,358,134	R1142H	probably benign	Het
Mtmr3	G	A	11: 4,497,381	Q360*	probably null	Het
Muc6	T	C	7: 141,651,115	N252S	probably benign	Het
Naa20	T	C	2: 145,903,320	L4P	probably damaging	Het
Neb	T	A	2: 52,222,961	I4274L	probably benign	Het
Noa1	A	T	5: 77,309,669	F130I	probably benign	Het
Nrg4	G	T	9: 55,236,512	H87N	possibly damaging	Het
Olfr1024	T	A	2: 85,904,505	Y183F	probably damaging	Het
Olfr632	T	A	7: 103,937,534	H51Q	probably benign	Het
P3h3	C	T	6: 124,845,601	E536K	probably damaging	Het
Pcdhb11	T	C	18: 37,421,718	S34P	probably damaging	Het
Pik3r1	T	C	13: 101,689,406	T71A	possibly damaging	Het
Plaur	T	A	7: 24,466,800	C99S	possibly damaging	Het
Plekha5	G	A	6: 140,586,436	G501E	probably damaging	Het
Plxnd1	C	T	6: 115,977,960	V614M	probably benign	Het
Ppp2r3a	T	C	9: 101,148,587	D307G	possibly damaging	Het
Prl3d3	C	T	13: 27,157,470	S28F	possibly damaging	Het
Prpf40a	T	C	2: 53,157,915	M197V	probably benign	Het
Ptk7	C	A	17: 46,572,642	Q832H	probably damaging	Het
Qser1	T	C	2: 104,790,090	S126G	probably benign	Het
Rab3ip	A	T	10: 116,915,867	C332S	probably damaging	Het
Raly	C	A	2: 154,857,366	T30K	probably damaging	Het
Rbp2	G	T	9: 98,490,647	S13I	probably benign	Het
Rps6ka1	C	T	4: 133,867,224	M159I	possibly damaging	Het
Rufy3	C	T	5: 88,584,309	T57I	probably benign	Het
Samd4	A	G	14: 47,016,631	D184G	probably damaging	Het
Slc35f3	T	C	8: 126,321,094	C58R	possibly damaging	Het
Smarca4	T	C	9: 21,699,877	I1467T	probably damaging	Het
Spag17	T	G	3: 100,065,585	I1371S	probably benign	Het
Sptan1	T	C	2: 30,007,549	L1228P	possibly damaging	Het
Stk31	C	T	6: 49,421,697	A344V	probably benign	Het
Supt16	A	G	14: 52,170,834	W885R	probably damaging	Het
Tdrd9	T	A	12: 112,025,900		probably null	Het
Tmod1	A	G	4: 46,078,469		probably null	Het
Tnfsf13	A	C	11: 69,684,483		probably null	Het
Trim75	C	A	8: 64,983,442	E119*	probably null	Het
Wdr6	T	C	9: 108,574,911	Y591C	probably damaging	Het
Wdr86	C	T	5: 24,718,283	R137H	probably benign	Het
Ythdf1	T	A	2: 180,911,150	Y424F	probably damaging	Het
Zfp984	G	T	4: 147,756,186	S69R	possibly damaging	Het
Zyg11a	A	G	4: 108,181,794	F743L	probably damaging	Het

Other mutations in App

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00834:App	APN	16	84965711	missense	probably damaging	0.99
IGL01457:App	APN	16	85103239	missense	probably damaging	1.00
IGL02016:App	APN	16	85056521	missense	unknown
IGL02135:App	APN	16	85079838	critical splice donor site	probably null
IGL02338:App	APN	16	85173519	missense	probably benign	0.01
IGL02377:App	APN	16	85082831	missense	probably benign	0.07
IGL02516:App	APN	16	84955417	missense	probably damaging	1.00
IGL02565:App	APN	16	85025420	splice site	probably null
IGL03179:App	APN	16	85082847	missense	probably damaging	1.00
BB005:App	UTSW	16	84978246	missense	probably benign	0.05
BB015:App	UTSW	16	84978246	missense	probably benign	0.05
LCD18:App	UTSW	16	85025412	splice site	probably benign
R0349:App	UTSW	16	85013680	missense	probably damaging	1.00
R0440:App	UTSW	16	85056414	nonsense	probably null
R0515:App	UTSW	16	85103344	splice site	probably benign
R0730:App	UTSW	16	85079952	missense	probably damaging	0.98
R1609:App	UTSW	16	85079949	missense	probably damaging	0.97
R1703:App	UTSW	16	84965768	missense	probably damaging	1.00
R2516:App	UTSW	16	84978229	missense	probably damaging	0.97
R4366:App	UTSW	16	85056433	missense	unknown
R4735:App	UTSW	16	85103314	missense	probably damaging	0.99
R4849:App	UTSW	16	85056434	missense	unknown
R4851:App	UTSW	16	85056434	missense	unknown
R6489:App	UTSW	16	85056520	missense	unknown
R6796:App	UTSW	16	85120567	missense	probably damaging	0.98
R7132:App	UTSW	16	85056482	missense	unknown
R7194:App	UTSW	16	85025431	missense	probably benign	0.40
R7456:App	UTSW	16	85173560
R7528:App	UTSW	16	84978258	missense	possibly damaging	0.89
R7594:App	UTSW	16	85080002	missense	unknown
R7699:App	UTSW	16	85040309	critical splice acceptor site	probably null
R7700:App	UTSW	16	85040309	critical splice acceptor site	probably null
R7928:App	UTSW	16	84978246	missense	probably benign	0.05
R8086:App	UTSW	16	85120540	missense	unknown
R8346:App	UTSW	16	85103257	missense	unknown
R8506:App	UTSW	16	85082816	missense	unknown
Z1176:App	UTSW	16	85024917	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCAGGTCCTTCTCTCAAAAG -3'
(R):5'- CACACGGCATGTAGTCAGTAG -3'

Sequencing Primer
(F):5'- GCAACTGTTACCATGGGGAC -3'
(R):5'- TCAGTAGGAATGGCCGCTG -3'

Posted On

2018-02-28