Mutagenetix > Incidental Mutations

Incidental Mutation 'R6254:Ptk7'

506025

Institutional Source

Beutler Lab

Gene Symbol

Ptk7

Ensembl Gene

ENSMUSG00000023972

Gene Name

PTK7 protein tyrosine kinase 7

Synonyms

8430404F20Rik, mPTK7/CCK4, chz

MMRRC Submission

044371-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6254 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46564451-46629504 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 46572642 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 832 (Q832H)

Ref Sequence

ENSEMBL: ENSMUSP00000043703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044442]

Predicted Effect

probably damaging
Transcript: ENSMUST00000044442
AA Change: Q832H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043703
Gene: ENSMUSG00000023972
AA Change: Q832H

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IGc2	36	100	1.48e-6	SMART
IGc2	133	199	8.12e-13	SMART
IGc2	229	300	5.01e-4	SMART
IGc2	326	390	1.96e-6	SMART
IG	410	491	6.02e-7	SMART
IGc2	507	569	1.19e-10	SMART
IGc2	596	663	2.6e-11	SMART
transmembrane domain	696	718	N/A	INTRINSIC
TyrKc	788	1053	4.34e-115	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181301

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.4%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine kinase family of proteins that transduce extracellular signals across the cell membrane. The encoded protein lacks detectable catalytic tyrosine kinase activity, is involved in the Wnt signaling pathway and plays a role in multiple cellular processes including polarity and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele die perinatally with defects in neural tube closure and planar cell polarity in the ear. ENU-induced mutant mice show omphalocele, impaired neural tube, heart and lung development, rib defects, polydactyly, failed eyelid closure and altered cell polarity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932443I19Rik	A	G	8: 13,706,043	D26G	possibly damaging	Het
Adam6b	A	T	12: 113,489,570	L2F	probably damaging	Het
Ank2	T	A	3: 126,941,804		probably benign	Het
Anpep	T	G	7: 79,839,233	D369A	probably damaging	Het
App	T	C	16: 84,978,177	E599G	probably damaging	Het
Asphd1	C	T	7: 126,948,868	V88I	probably benign	Het
Atad5	A	T	11: 80,127,389	I1389F	probably damaging	Het
Blm	T	C	7: 80,480,342	N950S	probably benign	Het
Bsn	A	T	9: 108,111,866	M2229K	probably damaging	Het
Cacna2d2	A	G	9: 107,509,216	M181V	probably benign	Het
Cadps2	T	A	6: 23,329,163		probably null	Het
Cdh1	T	A	8: 106,663,798	V590D	probably damaging	Het
Cdk5rap2	G	A	4: 70,364,032	T160M	probably damaging	Het
Chrna5	A	G	9: 55,006,456	M325V	probably benign	Het
Clca3a2	A	G	3: 144,802,134	I116T	probably benign	Het
Cyp2c23	T	C	19: 44,005,463	K488R	probably benign	Het
Edil3	T	A	13: 89,319,729	I451N	probably damaging	Het
Exph5	T	G	9: 53,372,710	S364A	possibly damaging	Het
Fam84b	A	G	15: 60,823,801	I32T	probably damaging	Het
Fam98c	A	G	7: 29,154,517	S209P	probably damaging	Het
Fat3	G	A	9: 15,996,145	L2854F	probably benign	Het
Fbxo38	T	C	18: 62,505,500		probably null	Het
Fermt2	T	C	14: 45,476,059	D205G	probably damaging	Het
Fmnl1	G	A	11: 103,196,315		probably benign	Het
Fn3k	A	G	11: 121,435,068	E27G	probably damaging	Het
Foxj2	A	G	6: 122,838,139	H378R	probably damaging	Het
Fubp1	A	G	3: 152,232,408	K140E	possibly damaging	Het
Gm4788	A	G	1: 139,754,390	I156T	probably damaging	Het
Gm7694	A	T	1: 170,302,534	C98*	probably null	Het
Golgb1	T	C	16: 36,913,978	S1196P	probably damaging	Het
Gpm6a	G	A	8: 55,047,396		probably null	Het
Hltf	T	A	3: 20,063,829	N80K	possibly damaging	Het
Il1rap	G	A	16: 26,695,270	R251H	probably benign	Het
Ipo7	T	A	7: 110,049,060	D688E	probably benign	Het
Itgal	T	A	7: 127,325,203	N897K	probably damaging	Het
Itsn2	A	G	12: 4,624,982		probably null	Het
Kcnk13	A	G	12: 99,965,372		probably benign	Het
Kdm7a	A	G	6: 39,170,269	L248P	probably damaging	Het
Kmt2c	T	C	5: 25,349,874	E1254G	possibly damaging	Het
Ldah	G	A	12: 8,275,912		probably benign	Het
Lingo1	T	A	9: 56,620,087	D406V	possibly damaging	Het
Lrriq1	A	T	10: 103,215,451	V480E	probably benign	Het
Mtcl1	C	T	17: 66,358,134	R1142H	probably benign	Het
Mtmr3	G	A	11: 4,497,381	Q360*	probably null	Het
Muc6	T	C	7: 141,651,115	N252S	probably benign	Het
Naa20	T	C	2: 145,903,320	L4P	probably damaging	Het
Neb	T	A	2: 52,222,961	I4274L	probably benign	Het
Noa1	A	T	5: 77,309,669	F130I	probably benign	Het
Nrg4	G	T	9: 55,236,512	H87N	possibly damaging	Het
Olfr1024	T	A	2: 85,904,505	Y183F	probably damaging	Het
Olfr632	T	A	7: 103,937,534	H51Q	probably benign	Het
P3h3	C	T	6: 124,845,601	E536K	probably damaging	Het
Pcdhb11	T	C	18: 37,421,718	S34P	probably damaging	Het
Pik3r1	T	C	13: 101,689,406	T71A	possibly damaging	Het
Plaur	T	A	7: 24,466,800	C99S	possibly damaging	Het
Plekha5	G	A	6: 140,586,436	G501E	probably damaging	Het
Plxnd1	C	T	6: 115,977,960	V614M	probably benign	Het
Ppp2r3a	T	C	9: 101,148,587	D307G	possibly damaging	Het
Prl3d3	C	T	13: 27,157,470	S28F	possibly damaging	Het
Prpf40a	T	C	2: 53,157,915	M197V	probably benign	Het
Qser1	T	C	2: 104,790,090	S126G	probably benign	Het
Rab3ip	A	T	10: 116,915,867	C332S	probably damaging	Het
Raly	C	A	2: 154,857,366	T30K	probably damaging	Het
Rbp2	G	T	9: 98,490,647	S13I	probably benign	Het
Rps6ka1	C	T	4: 133,867,224	M159I	possibly damaging	Het
Rufy3	C	T	5: 88,584,309	T57I	probably benign	Het
Samd4	A	G	14: 47,016,631	D184G	probably damaging	Het
Slc35f3	T	C	8: 126,321,094	C58R	possibly damaging	Het
Smarca4	T	C	9: 21,699,877	I1467T	probably damaging	Het
Spag17	T	G	3: 100,065,585	I1371S	probably benign	Het
Sptan1	T	C	2: 30,007,549	L1228P	possibly damaging	Het
Stk31	C	T	6: 49,421,697	A344V	probably benign	Het
Supt16	A	G	14: 52,170,834	W885R	probably damaging	Het
Tdrd9	T	A	12: 112,025,900		probably null	Het
Tmod1	A	G	4: 46,078,469		probably null	Het
Tnfsf13	A	C	11: 69,684,483		probably null	Het
Trim75	C	A	8: 64,983,442	E119*	probably null	Het
Wdr6	T	C	9: 108,574,911	Y591C	probably damaging	Het
Wdr86	C	T	5: 24,718,283	R137H	probably benign	Het
Ythdf1	T	A	2: 180,911,150	Y424F	probably damaging	Het
Zfp984	G	T	4: 147,756,186	S69R	possibly damaging	Het
Zyg11a	A	G	4: 108,181,794	F743L	probably damaging	Het

Other mutations in Ptk7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Ptk7	APN	17	46574427	missense	probably damaging	1.00
IGL01064:Ptk7	APN	17	46573566	nonsense	probably null
IGL01444:Ptk7	APN	17	46565387	missense	probably damaging	1.00
IGL01477:Ptk7	APN	17	46576880	missense	possibly damaging	0.61
IGL01727:Ptk7	APN	17	46572548	missense	probably damaging	1.00
IGL01958:Ptk7	APN	17	46579427	missense	probably benign	0.37
IGL02496:Ptk7	APN	17	46590144	missense	probably benign	0.04
IGL02864:Ptk7	APN	17	46572733	missense	probably damaging	1.00
R0008:Ptk7	UTSW	17	46572762	splice site	probably benign
R0671:Ptk7	UTSW	17	46590312	missense	possibly damaging	0.94
R1464:Ptk7	UTSW	17	46572591	missense	probably damaging	1.00
R1464:Ptk7	UTSW	17	46572591	missense	probably damaging	1.00
R1549:Ptk7	UTSW	17	46572652	missense	probably damaging	1.00
R1635:Ptk7	UTSW	17	46573534	missense	possibly damaging	0.81
R1646:Ptk7	UTSW	17	46586297	missense	probably benign	0.44
R1846:Ptk7	UTSW	17	46576490	critical splice donor site	probably null
R1973:Ptk7	UTSW	17	46586807	nonsense	probably null
R2060:Ptk7	UTSW	17	46566238	missense	possibly damaging	0.83
R2155:Ptk7	UTSW	17	46579617	missense	probably benign	0.09
R2472:Ptk7	UTSW	17	46576848	missense	probably benign	0.35
R2937:Ptk7	UTSW	17	46572550	missense	probably damaging	0.99
R3824:Ptk7	UTSW	17	46565378	missense	probably damaging	1.00
R3845:Ptk7	UTSW	17	46586418	missense	probably benign	0.00
R4222:Ptk7	UTSW	17	46574463	missense	probably benign
R4671:Ptk7	UTSW	17	46574466	missense	probably benign
R4922:Ptk7	UTSW	17	46576491	critical splice donor site	probably null
R5319:Ptk7	UTSW	17	46572677	missense	probably damaging	1.00
R5993:Ptk7	UTSW	17	46565370	missense	probably benign
R6352:Ptk7	UTSW	17	46576890	missense	probably benign	0.00
R6806:Ptk7	UTSW	17	46573528	missense	probably damaging	0.99
R7338:Ptk7	UTSW	17	46579599	missense	probably benign	0.00
R7394:Ptk7	UTSW	17	46591757	missense	probably damaging	1.00
R7709:Ptk7	UTSW	17	46571643	missense	possibly damaging	0.81
R7949:Ptk7	UTSW	17	46586461	missense	possibly damaging	0.64

Predicted Primers

PCR Primer
(F):5'- TTGACCTCCAGAAAGACGGG -3'
(R):5'- CTCTAAGAAAGGCCACGGTG -3'

Sequencing Primer
(F):5'- AAGCTCTGTCTGCGACCAG -3'
(R):5'- ACGGTGGCTGCATCTCTC -3'

Posted On

2018-02-28