Incidental Mutation 'R6254:Mtcl1'
ID506026
Institutional Source Beutler Lab
Gene Symbol Mtcl1
Ensembl Gene ENSMUSG00000052105
Gene Namemicrotubule crosslinking factor 1
SynonymsSoga2, t8219b25, 1110012J17Rik
MMRRC Submission 044371-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R6254 (G1)
Quality Score170.009
Status Validated
Chromosome17
Chromosomal Location66336982-66449750 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66358134 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1142 (R1142H)
Ref Sequence ENSEMBL: ENSMUSP00000094894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086693] [ENSMUST00000097291] [ENSMUST00000145347] [ENSMUST00000177034]
Predicted Effect probably benign
Transcript: ENSMUST00000086693
AA Change: R1142H

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000083899
Gene: ENSMUSG00000052105
AA Change: R1142H

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
low complexity region 54 98 N/A INTRINSIC
low complexity region 99 120 N/A INTRINSIC
low complexity region 127 132 N/A INTRINSIC
low complexity region 166 183 N/A INTRINSIC
low complexity region 240 259 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
SCOP:d1fxkc_ 332 466 3e-7 SMART
Blast:BRLZ 339 362 1e-5 BLAST
Pfam:DUF3166 493 587 1.8e-34 PFAM
Pfam:DUF3166 622 714 3.8e-39 PFAM
low complexity region 843 859 N/A INTRINSIC
low complexity region 896 910 N/A INTRINSIC
low complexity region 962 973 N/A INTRINSIC
low complexity region 1049 1062 N/A INTRINSIC
coiled coil region 1120 1159 N/A INTRINSIC
Pfam:DUF4482 1220 1344 3e-40 PFAM
low complexity region 1464 1476 N/A INTRINSIC
low complexity region 1672 1681 N/A INTRINSIC
low complexity region 1912 1924 N/A INTRINSIC
low complexity region 1931 1943 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097291
AA Change: R1142H

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000094894
Gene: ENSMUSG00000052105
AA Change: R1142H

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
low complexity region 54 98 N/A INTRINSIC
low complexity region 99 120 N/A INTRINSIC
low complexity region 127 132 N/A INTRINSIC
low complexity region 166 183 N/A INTRINSIC
low complexity region 240 259 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
SCOP:d1fxkc_ 332 466 3e-7 SMART
Blast:BRLZ 339 362 1e-5 BLAST
Pfam:DUF3166 492 588 1.8e-43 PFAM
Pfam:DUF3166 621 716 5e-19 PFAM
low complexity region 843 859 N/A INTRINSIC
low complexity region 896 910 N/A INTRINSIC
low complexity region 962 973 N/A INTRINSIC
low complexity region 1049 1062 N/A INTRINSIC
coiled coil region 1120 1159 N/A INTRINSIC
Pfam:DUF4482 1220 1392 3.9e-49 PFAM
low complexity region 1464 1476 N/A INTRINSIC
low complexity region 1672 1681 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144492
Predicted Effect probably benign
Transcript: ENSMUST00000145347
AA Change: R693H

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000121387
Gene: ENSMUSG00000052105
AA Change: R693H

DomainStartEndE-ValueType
Pfam:DUF3166 43 139 9.1e-44 PFAM
Pfam:DUF3166 172 267 2.5e-19 PFAM
low complexity region 394 410 N/A INTRINSIC
low complexity region 447 461 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
low complexity region 600 613 N/A INTRINSIC
coiled coil region 671 710 N/A INTRINSIC
Pfam:DUF4482 771 910 4.6e-49 PFAM
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1223 1232 N/A INTRINSIC
low complexity region 1463 1475 N/A INTRINSIC
low complexity region 1482 1494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177034
AA Change: R831H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000135690
Gene: ENSMUSG00000052105
AA Change: R831H

DomainStartEndE-ValueType
Pfam:DUF3166 140 236 1.5e-43 PFAM
Pfam:DUF3166 269 364 4e-19 PFAM
low complexity region 491 507 N/A INTRINSIC
low complexity region 544 558 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
coiled coil region 642 674 N/A INTRINSIC
low complexity region 738 751 N/A INTRINSIC
coiled coil region 809 848 N/A INTRINSIC
Pfam:DUF4482 909 1042 4e-49 PFAM
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1369 1378 N/A INTRINSIC
Meta Mutation Damage Score 0.0629 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.4%
Validation Efficiency 100% (82/82)
MGI Phenotype PHENOTYPE: Global or Purkinje cell-specific homozygous knockout affects Purkinje cell axon and dendrite morphology, resulting in abnormal motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik A G 8: 13,706,043 D26G possibly damaging Het
Adam6b A T 12: 113,489,570 L2F probably damaging Het
Ank2 T A 3: 126,941,804 probably benign Het
Anpep T G 7: 79,839,233 D369A probably damaging Het
App T C 16: 84,978,177 E599G probably damaging Het
Asphd1 C T 7: 126,948,868 V88I probably benign Het
Atad5 A T 11: 80,127,389 I1389F probably damaging Het
Blm T C 7: 80,480,342 N950S probably benign Het
Bsn A T 9: 108,111,866 M2229K probably damaging Het
Cacna2d2 A G 9: 107,509,216 M181V probably benign Het
Cadps2 T A 6: 23,329,163 probably null Het
Cdh1 T A 8: 106,663,798 V590D probably damaging Het
Cdk5rap2 G A 4: 70,364,032 T160M probably damaging Het
Chrna5 A G 9: 55,006,456 M325V probably benign Het
Clca3a2 A G 3: 144,802,134 I116T probably benign Het
Cyp2c23 T C 19: 44,005,463 K488R probably benign Het
Edil3 T A 13: 89,319,729 I451N probably damaging Het
Exph5 T G 9: 53,372,710 S364A possibly damaging Het
Fam84b A G 15: 60,823,801 I32T probably damaging Het
Fam98c A G 7: 29,154,517 S209P probably damaging Het
Fat3 G A 9: 15,996,145 L2854F probably benign Het
Fbxo38 T C 18: 62,505,500 probably null Het
Fermt2 T C 14: 45,476,059 D205G probably damaging Het
Fmnl1 G A 11: 103,196,315 probably benign Het
Fn3k A G 11: 121,435,068 E27G probably damaging Het
Foxj2 A G 6: 122,838,139 H378R probably damaging Het
Fubp1 A G 3: 152,232,408 K140E possibly damaging Het
Gm4788 A G 1: 139,754,390 I156T probably damaging Het
Gm7694 A T 1: 170,302,534 C98* probably null Het
Golgb1 T C 16: 36,913,978 S1196P probably damaging Het
Gpm6a G A 8: 55,047,396 probably null Het
Hltf T A 3: 20,063,829 N80K possibly damaging Het
Il1rap G A 16: 26,695,270 R251H probably benign Het
Ipo7 T A 7: 110,049,060 D688E probably benign Het
Itgal T A 7: 127,325,203 N897K probably damaging Het
Itsn2 A G 12: 4,624,982 probably null Het
Kcnk13 A G 12: 99,965,372 probably benign Het
Kdm7a A G 6: 39,170,269 L248P probably damaging Het
Kmt2c T C 5: 25,349,874 E1254G possibly damaging Het
Ldah G A 12: 8,275,912 probably benign Het
Lingo1 T A 9: 56,620,087 D406V possibly damaging Het
Lrriq1 A T 10: 103,215,451 V480E probably benign Het
Mtmr3 G A 11: 4,497,381 Q360* probably null Het
Muc6 T C 7: 141,651,115 N252S probably benign Het
Naa20 T C 2: 145,903,320 L4P probably damaging Het
Neb T A 2: 52,222,961 I4274L probably benign Het
Noa1 A T 5: 77,309,669 F130I probably benign Het
Nrg4 G T 9: 55,236,512 H87N possibly damaging Het
Olfr1024 T A 2: 85,904,505 Y183F probably damaging Het
Olfr632 T A 7: 103,937,534 H51Q probably benign Het
P3h3 C T 6: 124,845,601 E536K probably damaging Het
Pcdhb11 T C 18: 37,421,718 S34P probably damaging Het
Pik3r1 T C 13: 101,689,406 T71A possibly damaging Het
Plaur T A 7: 24,466,800 C99S possibly damaging Het
Plekha5 G A 6: 140,586,436 G501E probably damaging Het
Plxnd1 C T 6: 115,977,960 V614M probably benign Het
Ppp2r3a T C 9: 101,148,587 D307G possibly damaging Het
Prl3d3 C T 13: 27,157,470 S28F possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Ptk7 C A 17: 46,572,642 Q832H probably damaging Het
Qser1 T C 2: 104,790,090 S126G probably benign Het
Rab3ip A T 10: 116,915,867 C332S probably damaging Het
Raly C A 2: 154,857,366 T30K probably damaging Het
Rbp2 G T 9: 98,490,647 S13I probably benign Het
Rps6ka1 C T 4: 133,867,224 M159I possibly damaging Het
Rufy3 C T 5: 88,584,309 T57I probably benign Het
Samd4 A G 14: 47,016,631 D184G probably damaging Het
Slc35f3 T C 8: 126,321,094 C58R possibly damaging Het
Smarca4 T C 9: 21,699,877 I1467T probably damaging Het
Spag17 T G 3: 100,065,585 I1371S probably benign Het
Sptan1 T C 2: 30,007,549 L1228P possibly damaging Het
Stk31 C T 6: 49,421,697 A344V probably benign Het
Supt16 A G 14: 52,170,834 W885R probably damaging Het
Tdrd9 T A 12: 112,025,900 probably null Het
Tmod1 A G 4: 46,078,469 probably null Het
Tnfsf13 A C 11: 69,684,483 probably null Het
Trim75 C A 8: 64,983,442 E119* probably null Het
Wdr6 T C 9: 108,574,911 Y591C probably damaging Het
Wdr86 C T 5: 24,718,283 R137H probably benign Het
Ythdf1 T A 2: 180,911,150 Y424F probably damaging Het
Zfp984 G T 4: 147,756,186 S69R possibly damaging Het
Zyg11a A G 4: 108,181,794 F743L probably damaging Het
Other mutations in Mtcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Mtcl1 APN 17 66344319 missense probably benign 0.00
IGL01774:Mtcl1 APN 17 66385885 missense probably damaging 1.00
IGL01918:Mtcl1 APN 17 66368268 missense possibly damaging 0.47
IGL02000:Mtcl1 APN 17 66354190 missense probably benign 0.19
IGL02074:Mtcl1 APN 17 66366468 missense possibly damaging 0.68
IGL02338:Mtcl1 APN 17 66379970 missense probably damaging 1.00
IGL02597:Mtcl1 APN 17 66338021 missense probably benign
IGL03034:Mtcl1 APN 17 66344198 missense probably damaging 1.00
IGL03120:Mtcl1 APN 17 66379383 missense probably damaging 0.96
IGL03184:Mtcl1 APN 17 66354214 missense probably benign 0.01
IGL03240:Mtcl1 APN 17 66338019 missense probably damaging 1.00
IGL03294:Mtcl1 APN 17 66338019 missense probably damaging 1.00
IGL03332:Mtcl1 APN 17 66338019 missense probably damaging 1.00
PIT4378001:Mtcl1 UTSW 17 66438279 missense probably damaging 1.00
PIT4520001:Mtcl1 UTSW 17 66385912 missense possibly damaging 0.48
R0110:Mtcl1 UTSW 17 66358114 missense possibly damaging 0.51
R0113:Mtcl1 UTSW 17 66354242 missense possibly damaging 0.52
R0321:Mtcl1 UTSW 17 66379431 missense probably damaging 1.00
R0366:Mtcl1 UTSW 17 66338129 missense probably damaging 1.00
R0629:Mtcl1 UTSW 17 66338142 missense possibly damaging 0.89
R1466:Mtcl1 UTSW 17 66380435 missense probably damaging 1.00
R1467:Mtcl1 UTSW 17 66448327 missense probably damaging 1.00
R1471:Mtcl1 UTSW 17 66379148 missense probably damaging 0.96
R1650:Mtcl1 UTSW 17 66385876 missense probably damaging 1.00
R1754:Mtcl1 UTSW 17 66380183 missense probably damaging 1.00
R1855:Mtcl1 UTSW 17 66379514 missense probably benign
R1882:Mtcl1 UTSW 17 66379320 missense probably benign 0.01
R1935:Mtcl1 UTSW 17 66379414 missense probably benign 0.10
R2063:Mtcl1 UTSW 17 66346355 missense probably damaging 1.00
R2132:Mtcl1 UTSW 17 66343623 missense probably benign 0.04
R2197:Mtcl1 UTSW 17 66366432 missense probably benign
R3196:Mtcl1 UTSW 17 66343834 missense probably benign 0.07
R3877:Mtcl1 UTSW 17 66342954 missense probably damaging 1.00
R4116:Mtcl1 UTSW 17 66366481 missense probably benign
R4204:Mtcl1 UTSW 17 66438261 missense probably damaging 1.00
R4373:Mtcl1 UTSW 17 66380079 missense probably benign 0.05
R4396:Mtcl1 UTSW 17 66344225 missense probably damaging 1.00
R4591:Mtcl1 UTSW 17 66348511 missense probably benign 0.07
R4610:Mtcl1 UTSW 17 66377887 missense probably benign 0.04
R4681:Mtcl1 UTSW 17 66449144 missense unknown
R4922:Mtcl1 UTSW 17 66348479 missense probably benign 0.29
R4992:Mtcl1 UTSW 17 66342839 missense probably damaging 0.99
R5169:Mtcl1 UTSW 17 66343823 missense probably benign 0.00
R5542:Mtcl1 UTSW 17 66384359 intron probably benign
R5804:Mtcl1 UTSW 17 66343137 missense probably benign 0.03
R5998:Mtcl1 UTSW 17 66368280 missense probably damaging 0.99
R6163:Mtcl1 UTSW 17 66379331 missense probably benign 0.10
R6191:Mtcl1 UTSW 17 66343526 missense probably damaging 1.00
R6260:Mtcl1 UTSW 17 66343541 missense probably damaging 1.00
R6524:Mtcl1 UTSW 17 66348285 missense probably benign 0.15
R6884:Mtcl1 UTSW 17 66438202 missense probably damaging 1.00
R7199:Mtcl1 UTSW 17 66340539 missense probably benign 0.13
R7431:Mtcl1 UTSW 17 66342906 nonsense probably null
R7479:Mtcl1 UTSW 17 66379490 missense probably benign
R7564:Mtcl1 UTSW 17 66371327 missense probably benign
R7608:Mtcl1 UTSW 17 66343305 missense probably damaging 0.96
R7691:Mtcl1 UTSW 17 66380357 missense probably damaging 1.00
X0065:Mtcl1 UTSW 17 66379607 missense probably damaging 1.00
Z1088:Mtcl1 UTSW 17 66343728 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GAGAACCTACCTGTGCCTCTTC -3'
(R):5'- GACCATCTTGCCTCTATTCAGAG -3'

Sequencing Primer
(F):5'- ACCCATCCTGGATAGGGTAG -3'
(R):5'- CTCTATTCAGAGGTCGGAGGC -3'
Posted On2018-02-28