Incidental Mutation 'R6255:Cfhr4'
ID 506032
Institutional Source Beutler Lab
Gene Symbol Cfhr4
Ensembl Gene ENSMUSG00000070594
Gene Name complement factor H-related 4
Synonyms Gm4788
MMRRC Submission 044372-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R6255 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 139625657-139708977 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 139680749 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 256 (C256*)
Ref Sequence ENSEMBL: ENSMUSP00000107620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027612] [ENSMUST00000111986] [ENSMUST00000111989]
AlphaFold E9Q8B5
Predicted Effect probably null
Transcript: ENSMUST00000027612
AA Change: C256*
SMART Domains Protein: ENSMUSP00000027612
Gene: ENSMUSG00000070594
AA Change: C256*

DomainStartEndE-ValueType
CCP 28 88 1.65e-2 SMART
CCP 92 145 1.15e-10 SMART
CCP 151 208 5.65e-10 SMART
CCP 212 267 1.12e-4 SMART
CCP 272 325 4.52e-9 SMART
CCP 332 386 9.1e-14 SMART
CCP 393 446 1.58e-13 SMART
CCP 455 505 4.92e-1 SMART
CCP 511 564 8.9e-8 SMART
CCP 569 622 4.18e-13 SMART
CCP 627 681 3.5e-15 SMART
CCP 688 742 5.69e-15 SMART
CCP 746 807 2.77e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111986
AA Change: C256*
SMART Domains Protein: ENSMUSP00000107617
Gene: ENSMUSG00000070594
AA Change: C256*

DomainStartEndE-ValueType
CCP 28 88 1.65e-2 SMART
CCP 92 145 1.15e-10 SMART
CCP 151 208 5.65e-10 SMART
CCP 212 267 1.12e-4 SMART
CCP 272 325 4.52e-9 SMART
CCP 333 387 9.1e-14 SMART
CCP 394 447 1.58e-13 SMART
CCP 456 506 4.92e-1 SMART
CCP 512 565 8.9e-8 SMART
CCP 571 635 2.66e-6 SMART
CCP 640 693 4.18e-13 SMART
CCP 700 754 5.69e-15 SMART
CCP 758 819 2.77e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111989
AA Change: C256*
SMART Domains Protein: ENSMUSP00000107620
Gene: ENSMUSG00000070594
AA Change: C256*

DomainStartEndE-ValueType
CCP 28 88 1.65e-2 SMART
CCP 92 145 1.15e-10 SMART
CCP 151 208 5.65e-10 SMART
CCP 212 267 1.12e-4 SMART
CCP 272 325 4.52e-9 SMART
CCP 333 387 9.1e-14 SMART
CCP 394 447 1.58e-13 SMART
CCP 456 506 4.92e-1 SMART
CCP 512 565 8.9e-8 SMART
CCP 571 635 2.66e-6 SMART
CCP 640 693 4.18e-13 SMART
CCP 698 752 3.5e-15 SMART
CCP 759 813 5.69e-15 SMART
CCP 817 878 2.77e0 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,602,659 (GRCm39) V7E possibly damaging Het
Aars2 G A 17: 45,825,535 (GRCm39) G333S probably damaging Het
Aen T A 7: 78,555,592 (GRCm39) I85N probably damaging Het
Ahnak C A 19: 8,985,389 (GRCm39) H2224Q possibly damaging Het
Aldh18a1 C T 19: 40,568,487 (GRCm39) R41H possibly damaging Het
Bpifb9b T A 2: 154,151,284 (GRCm39) W2R probably damaging Het
Caprin2 A G 6: 148,779,390 (GRCm39) I139T probably benign Het
Cdhr3 T A 12: 33,103,474 (GRCm39) N381I probably damaging Het
Cecr2 A G 6: 120,735,011 (GRCm39) Y721C probably damaging Het
Cherp G T 8: 73,224,725 (GRCm39) A125D probably damaging Het
Cped1 G A 6: 22,138,714 (GRCm39) probably null Het
Ctdp1 T A 18: 80,502,512 (GRCm39) probably null Het
Cyp2c55 T C 19: 39,007,111 (GRCm39) I169T probably benign Het
Cyp4a31 T C 4: 115,432,117 (GRCm39) L418P possibly damaging Het
Efcab7 T C 4: 99,717,627 (GRCm39) probably benign Het
Efcab8 T C 2: 153,652,188 (GRCm39) W466R possibly damaging Het
Ehd3 C A 17: 74,112,408 (GRCm39) N57K probably benign Het
Ern2 C A 7: 121,772,495 (GRCm39) K654N probably damaging Het
Fbh1 A T 2: 11,753,257 (GRCm39) F879L probably benign Het
Gde1 T C 7: 118,291,004 (GRCm39) D92G probably null Het
Heatr5b A G 17: 79,110,863 (GRCm39) V995A probably damaging Het
Ifrd2 A G 9: 107,469,290 (GRCm39) E346G probably damaging Het
Ism1 AACGGACCCGTTCTTGTGGCTATGCA AA 2: 139,587,962 (GRCm39) probably benign Het
Itgb4 T C 11: 115,888,963 (GRCm39) V1102A possibly damaging Het
Itgb6 A T 2: 60,435,620 (GRCm39) I710N probably damaging Het
Kif1a T C 1: 92,947,705 (GRCm39) K1578E probably damaging Het
Kif9 T C 9: 110,346,902 (GRCm39) probably null Het
Kitl T C 10: 99,925,095 (GRCm39) *57Q probably null Het
Lrat C A 3: 82,810,812 (GRCm39) V70F probably damaging Het
Lrrc9 T A 12: 72,533,797 (GRCm39) M1022K probably benign Het
Muc16 T C 9: 18,566,895 (GRCm39) T1875A unknown Het
Mup4 T A 4: 59,957,890 (GRCm39) N171I probably damaging Het
Npas4 G A 19: 5,036,403 (GRCm39) T587I probably damaging Het
Oas3 A G 5: 120,909,295 (GRCm39) V217A probably benign Het
Or6c1b A G 10: 129,273,557 (GRCm39) N292S possibly damaging Het
Osbp C A 19: 11,955,317 (GRCm39) A323D possibly damaging Het
Panx2 G A 15: 88,951,821 (GRCm39) R96H probably damaging Het
Pcdhb18 G A 18: 37,623,537 (GRCm39) R289Q probably benign Het
Piezo2 T C 18: 63,254,341 (GRCm39) R385G possibly damaging Het
Pkn2 T C 3: 142,517,360 (GRCm39) T476A probably damaging Het
Plekha4 T C 7: 45,203,226 (GRCm39) probably benign Het
Ppfibp2 T C 7: 107,280,969 (GRCm39) S94P probably damaging Het
Pramel7 T A 2: 87,320,007 (GRCm39) I429L probably benign Het
Rif1 A G 2: 51,975,065 (GRCm39) K325E probably damaging Het
Ror2 T C 13: 53,264,578 (GRCm39) Y826C probably damaging Het
Rsph10b G A 5: 143,896,564 (GRCm39) G19R probably damaging Het
Slc20a1 A G 2: 129,049,924 (GRCm39) N361D probably damaging Het
Slc26a9 A G 1: 131,691,647 (GRCm39) D630G probably benign Het
Smtnl2 G A 11: 72,292,225 (GRCm39) A274V probably damaging Het
Trank1 T C 9: 111,181,314 (GRCm39) probably null Het
Tspan10 T A 11: 120,335,368 (GRCm39) C159* probably null Het
Uba6 G A 5: 86,312,624 (GRCm39) T23I probably benign Het
Vmn2r74 T C 7: 85,601,659 (GRCm39) T660A possibly damaging Het
Vwa5b1 T C 4: 138,305,983 (GRCm39) N905S probably benign Het
Zfp831 T C 2: 174,488,214 (GRCm39) L963P possibly damaging Het
Zfp990 T A 4: 145,264,359 (GRCm39) N452K probably benign Het
Other mutations in Cfhr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Cfhr4 APN 1 139,659,312 (GRCm39) missense probably damaging 0.99
IGL01088:Cfhr4 APN 1 139,625,823 (GRCm39) utr 3 prime probably benign
IGL01419:Cfhr4 APN 1 139,667,382 (GRCm39) critical splice acceptor site probably null
IGL01552:Cfhr4 APN 1 139,667,040 (GRCm39) missense probably damaging 1.00
IGL01924:Cfhr4 APN 1 139,666,944 (GRCm39) missense probably damaging 0.99
IGL02032:Cfhr4 APN 1 139,702,284 (GRCm39) missense probably damaging 1.00
IGL02254:Cfhr4 APN 1 139,661,143 (GRCm39) splice site probably benign
IGL02318:Cfhr4 APN 1 139,708,835 (GRCm39) missense probably benign 0.20
IGL02527:Cfhr4 APN 1 139,680,783 (GRCm39) missense probably damaging 1.00
IGL02531:Cfhr4 APN 1 139,702,307 (GRCm39) missense probably benign 0.10
IGL02587:Cfhr4 APN 1 139,629,668 (GRCm39) missense probably damaging 1.00
IGL02644:Cfhr4 APN 1 139,708,905 (GRCm39) start codon destroyed probably null 0.63
IGL02852:Cfhr4 APN 1 139,701,754 (GRCm39) missense probably damaging 1.00
IGL02963:Cfhr4 APN 1 139,659,334 (GRCm39) nonsense probably null
IGL03084:Cfhr4 APN 1 139,708,880 (GRCm39) missense possibly damaging 0.94
R0131:Cfhr4 UTSW 1 139,682,009 (GRCm39) missense probably damaging 0.98
R0131:Cfhr4 UTSW 1 139,682,009 (GRCm39) missense probably damaging 0.98
R0132:Cfhr4 UTSW 1 139,682,009 (GRCm39) missense probably damaging 0.98
R0549:Cfhr4 UTSW 1 139,667,226 (GRCm39) missense probably damaging 1.00
R0558:Cfhr4 UTSW 1 139,667,230 (GRCm39) missense probably damaging 0.99
R0610:Cfhr4 UTSW 1 139,629,584 (GRCm39) missense probably benign 0.20
R1341:Cfhr4 UTSW 1 139,660,131 (GRCm39) missense probably damaging 0.98
R1460:Cfhr4 UTSW 1 139,625,934 (GRCm39) missense probably damaging 0.99
R1544:Cfhr4 UTSW 1 139,664,608 (GRCm39) missense probably damaging 1.00
R1873:Cfhr4 UTSW 1 139,702,398 (GRCm39) missense probably damaging 0.97
R2032:Cfhr4 UTSW 1 139,660,993 (GRCm39) splice site probably benign
R2111:Cfhr4 UTSW 1 139,702,417 (GRCm39) splice site probably benign
R2179:Cfhr4 UTSW 1 139,659,279 (GRCm39) missense probably damaging 1.00
R3806:Cfhr4 UTSW 1 139,680,773 (GRCm39) missense probably damaging 1.00
R4356:Cfhr4 UTSW 1 139,660,048 (GRCm39) missense probably damaging 1.00
R4747:Cfhr4 UTSW 1 139,625,922 (GRCm39) missense probably damaging 1.00
R4838:Cfhr4 UTSW 1 139,661,181 (GRCm39) missense probably damaging 1.00
R4867:Cfhr4 UTSW 1 139,702,213 (GRCm39) critical splice donor site probably null
R4910:Cfhr4 UTSW 1 139,702,301 (GRCm39) missense probably damaging 1.00
R4911:Cfhr4 UTSW 1 139,702,301 (GRCm39) missense probably damaging 1.00
R5050:Cfhr4 UTSW 1 139,664,578 (GRCm39) missense probably damaging 0.99
R5120:Cfhr4 UTSW 1 139,680,841 (GRCm39) missense probably benign 0.39
R5259:Cfhr4 UTSW 1 139,668,233 (GRCm39) missense probably damaging 1.00
R5504:Cfhr4 UTSW 1 139,629,558 (GRCm39) missense probably benign 0.18
R5825:Cfhr4 UTSW 1 139,702,336 (GRCm39) splice site probably null
R5949:Cfhr4 UTSW 1 139,660,887 (GRCm39) missense probably damaging 0.98
R6140:Cfhr4 UTSW 1 139,660,133 (GRCm39) missense probably damaging 1.00
R6200:Cfhr4 UTSW 1 139,682,073 (GRCm39) missense probably damaging 0.97
R6254:Cfhr4 UTSW 1 139,682,128 (GRCm39) missense probably damaging 0.98
R6334:Cfhr4 UTSW 1 139,701,662 (GRCm39) splice site probably null
R6611:Cfhr4 UTSW 1 139,660,128 (GRCm39) missense probably damaging 1.00
R6798:Cfhr4 UTSW 1 139,625,859 (GRCm39) missense probably benign 0.20
R6800:Cfhr4 UTSW 1 139,629,719 (GRCm39) missense possibly damaging 0.85
R6895:Cfhr4 UTSW 1 139,668,210 (GRCm39) missense possibly damaging 0.84
R6904:Cfhr4 UTSW 1 139,659,391 (GRCm39) missense possibly damaging 0.79
R6994:Cfhr4 UTSW 1 139,664,668 (GRCm39) missense possibly damaging 0.67
R7173:Cfhr4 UTSW 1 139,659,415 (GRCm39) nonsense probably null
R7184:Cfhr4 UTSW 1 139,660,822 (GRCm39) missense possibly damaging 0.65
R7192:Cfhr4 UTSW 1 139,667,033 (GRCm39) missense probably damaging 0.96
R7205:Cfhr4 UTSW 1 139,680,788 (GRCm39) nonsense probably null
R7302:Cfhr4 UTSW 1 139,667,436 (GRCm39) splice site probably null
R7308:Cfhr4 UTSW 1 139,682,041 (GRCm39) missense possibly damaging 0.71
R7735:Cfhr4 UTSW 1 139,660,039 (GRCm39) critical splice donor site probably null
R8006:Cfhr4 UTSW 1 139,664,590 (GRCm39) missense probably damaging 1.00
R8045:Cfhr4 UTSW 1 139,661,243 (GRCm39) missense probably damaging 0.99
R8188:Cfhr4 UTSW 1 139,625,868 (GRCm39) missense probably damaging 1.00
R8339:Cfhr4 UTSW 1 139,660,157 (GRCm39) missense probably damaging 1.00
R9156:Cfhr4 UTSW 1 139,660,085 (GRCm39) missense probably damaging 0.96
R9339:Cfhr4 UTSW 1 139,682,044 (GRCm39) missense probably benign 0.26
R9520:Cfhr4 UTSW 1 139,682,135 (GRCm39) missense probably damaging 0.99
R9525:Cfhr4 UTSW 1 139,702,250 (GRCm39) missense probably damaging 1.00
R9554:Cfhr4 UTSW 1 139,668,169 (GRCm39) missense probably benign 0.04
R9635:Cfhr4 UTSW 1 139,701,764 (GRCm39) missense probably damaging 1.00
R9669:Cfhr4 UTSW 1 139,708,872 (GRCm39) missense probably damaging 0.96
R9737:Cfhr4 UTSW 1 139,708,872 (GRCm39) missense probably damaging 0.96
X0009:Cfhr4 UTSW 1 139,661,287 (GRCm39) missense probably benign 0.08
X0024:Cfhr4 UTSW 1 139,661,247 (GRCm39) missense probably damaging 1.00
Z1088:Cfhr4 UTSW 1 139,681,999 (GRCm39) missense probably damaging 0.99
Z1176:Cfhr4 UTSW 1 139,661,186 (GRCm39) missense probably damaging 1.00
Z1176:Cfhr4 UTSW 1 139,625,994 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACATCAATGTCTTAGAAAATGGTCC -3'
(R):5'- AACCCTTGGTATAGTTCCAGTTTTAAG -3'

Sequencing Primer
(F):5'- AGAAAATGGTCCTTTTTCGTAGG -3'
(R):5'- AGGAAGTAAATTGTTGTTGTTCTCC -3'
Posted On 2018-02-28