Incidental Mutation 'R6255:Gm4788'
ID506032
Institutional Source Beutler Lab
Gene Symbol Gm4788
Ensembl Gene ENSMUSG00000070594
Gene Namepredicted gene 4788
Synonyms
MMRRC Submission 044372-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6255 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location139697623-139781243 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 139753011 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 256 (C256*)
Ref Sequence ENSEMBL: ENSMUSP00000107620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027612] [ENSMUST00000111986] [ENSMUST00000111989]
Predicted Effect probably null
Transcript: ENSMUST00000027612
AA Change: C256*
SMART Domains Protein: ENSMUSP00000027612
Gene: ENSMUSG00000070594
AA Change: C256*

DomainStartEndE-ValueType
CCP 28 88 1.65e-2 SMART
CCP 92 145 1.15e-10 SMART
CCP 151 208 5.65e-10 SMART
CCP 212 267 1.12e-4 SMART
CCP 272 325 4.52e-9 SMART
CCP 332 386 9.1e-14 SMART
CCP 393 446 1.58e-13 SMART
CCP 455 505 4.92e-1 SMART
CCP 511 564 8.9e-8 SMART
CCP 569 622 4.18e-13 SMART
CCP 627 681 3.5e-15 SMART
CCP 688 742 5.69e-15 SMART
CCP 746 807 2.77e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111986
AA Change: C256*
SMART Domains Protein: ENSMUSP00000107617
Gene: ENSMUSG00000070594
AA Change: C256*

DomainStartEndE-ValueType
CCP 28 88 1.65e-2 SMART
CCP 92 145 1.15e-10 SMART
CCP 151 208 5.65e-10 SMART
CCP 212 267 1.12e-4 SMART
CCP 272 325 4.52e-9 SMART
CCP 333 387 9.1e-14 SMART
CCP 394 447 1.58e-13 SMART
CCP 456 506 4.92e-1 SMART
CCP 512 565 8.9e-8 SMART
CCP 571 635 2.66e-6 SMART
CCP 640 693 4.18e-13 SMART
CCP 700 754 5.69e-15 SMART
CCP 758 819 2.77e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111989
AA Change: C256*
SMART Domains Protein: ENSMUSP00000107620
Gene: ENSMUSG00000070594
AA Change: C256*

DomainStartEndE-ValueType
CCP 28 88 1.65e-2 SMART
CCP 92 145 1.15e-10 SMART
CCP 151 208 5.65e-10 SMART
CCP 212 267 1.12e-4 SMART
CCP 272 325 4.52e-9 SMART
CCP 333 387 9.1e-14 SMART
CCP 394 447 1.58e-13 SMART
CCP 456 506 4.92e-1 SMART
CCP 512 565 8.9e-8 SMART
CCP 571 635 2.66e-6 SMART
CCP 640 693 4.18e-13 SMART
CCP 698 752 3.5e-15 SMART
CCP 759 813 5.69e-15 SMART
CCP 817 878 2.77e0 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,123 V7E possibly damaging Het
Aars2 G A 17: 45,514,609 G333S probably damaging Het
Aen T A 7: 78,905,844 I85N probably damaging Het
Ahnak C A 19: 9,008,025 H2224Q possibly damaging Het
Aldh18a1 C T 19: 40,580,043 R41H possibly damaging Het
Bpifb9b T A 2: 154,309,364 W2R probably damaging Het
Caprin2 A G 6: 148,877,892 I139T probably benign Het
Cdhr3 T A 12: 33,053,475 N381I probably damaging Het
Cecr2 A G 6: 120,758,050 Y721C probably damaging Het
Cherp G T 8: 72,470,881 A125D probably damaging Het
Cped1 G A 6: 22,138,715 probably null Het
Ctdp1 T A 18: 80,459,297 probably null Het
Cyp2c55 T C 19: 39,018,667 I169T probably benign Het
Cyp4a31 T C 4: 115,574,920 L418P possibly damaging Het
Efcab7 T C 4: 99,829,390 probably benign Het
Efcab8 T C 2: 153,810,268 W466R possibly damaging Het
Ehd3 C A 17: 73,805,413 N57K probably benign Het
Ern2 C A 7: 122,173,272 K654N probably damaging Het
Fbxo18 A T 2: 11,748,446 F879L probably benign Het
Gde1 T C 7: 118,691,781 D92G probably null Het
Heatr5b A G 17: 78,803,434 V995A probably damaging Het
Ifrd2 A G 9: 107,592,091 E346G probably damaging Het
Ism1 AACGGACCCGTTCTTGTGGCTATGCA AA 2: 139,746,042 probably benign Het
Itgb4 T C 11: 115,998,137 V1102A possibly damaging Het
Itgb6 A T 2: 60,605,276 I710N probably damaging Het
Kif1a T C 1: 93,019,983 K1578E probably damaging Het
Kif9 T C 9: 110,517,834 probably null Het
Kitl T C 10: 100,089,233 *57Q probably null Het
Lrat C A 3: 82,903,505 V70F probably damaging Het
Lrrc9 T A 12: 72,487,023 M1022K probably benign Het
Muc16 T C 9: 18,655,599 T1875A unknown Het
Mup4 T A 4: 59,957,890 N171I probably damaging Het
Npas4 G A 19: 4,986,375 T587I probably damaging Het
Oas3 A G 5: 120,771,230 V217A probably benign Het
Olfr786 A G 10: 129,437,688 N292S possibly damaging Het
Osbp C A 19: 11,977,953 A323D possibly damaging Het
Panx2 G A 15: 89,067,618 R96H probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Piezo2 T C 18: 63,121,270 R385G possibly damaging Het
Pkn2 T C 3: 142,811,599 T476A probably damaging Het
Plekha4 T C 7: 45,553,802 probably benign Het
Ppfibp2 T C 7: 107,681,762 S94P probably damaging Het
Pramel7 T A 2: 87,489,663 I429L probably benign Het
Rif1 A G 2: 52,085,053 K325E probably damaging Het
Ror2 T C 13: 53,110,542 Y826C probably damaging Het
Rsph10b G A 5: 143,959,746 G19R probably damaging Het
Slc20a1 A G 2: 129,208,004 N361D probably damaging Het
Slc26a9 A G 1: 131,763,909 D630G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Trank1 T C 9: 111,352,246 probably null Het
Tspan10 T A 11: 120,444,542 C159* probably null Het
Uba6 G A 5: 86,164,765 T23I probably benign Het
Vmn2r74 T C 7: 85,952,451 T660A possibly damaging Het
Vwa5b1 T C 4: 138,578,672 N905S probably benign Het
Zfp831 T C 2: 174,646,421 L963P possibly damaging Het
Zfp990 T A 4: 145,537,789 N452K probably benign Het
Other mutations in Gm4788
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Gm4788 APN 1 139731574 missense probably damaging 0.99
IGL01088:Gm4788 APN 1 139698085 utr 3 prime probably benign
IGL01419:Gm4788 APN 1 139739644 critical splice acceptor site probably null
IGL01552:Gm4788 APN 1 139739302 missense probably damaging 1.00
IGL01924:Gm4788 APN 1 139739206 missense probably damaging 0.99
IGL02032:Gm4788 APN 1 139774546 missense probably damaging 1.00
IGL02254:Gm4788 APN 1 139733405 splice site probably benign
IGL02318:Gm4788 APN 1 139781097 missense probably benign 0.20
IGL02527:Gm4788 APN 1 139753045 missense probably damaging 1.00
IGL02531:Gm4788 APN 1 139774569 missense probably benign 0.10
IGL02587:Gm4788 APN 1 139701930 missense probably damaging 1.00
IGL02644:Gm4788 APN 1 139781167 start codon destroyed probably null 0.63
IGL02852:Gm4788 APN 1 139774016 missense probably damaging 1.00
IGL02963:Gm4788 APN 1 139731596 nonsense probably null
IGL03084:Gm4788 APN 1 139781142 missense possibly damaging 0.94
R0131:Gm4788 UTSW 1 139754271 missense probably damaging 0.98
R0131:Gm4788 UTSW 1 139754271 missense probably damaging 0.98
R0132:Gm4788 UTSW 1 139754271 missense probably damaging 0.98
R0549:Gm4788 UTSW 1 139739488 missense probably damaging 1.00
R0558:Gm4788 UTSW 1 139739492 missense probably damaging 0.99
R0610:Gm4788 UTSW 1 139701846 missense probably benign 0.20
R1341:Gm4788 UTSW 1 139732393 missense probably damaging 0.98
R1460:Gm4788 UTSW 1 139698196 missense probably damaging 0.99
R1544:Gm4788 UTSW 1 139736870 missense probably damaging 1.00
R1873:Gm4788 UTSW 1 139774660 missense probably damaging 0.97
R2032:Gm4788 UTSW 1 139733255 splice site probably benign
R2111:Gm4788 UTSW 1 139774679 splice site probably benign
R2179:Gm4788 UTSW 1 139731541 missense probably damaging 1.00
R3806:Gm4788 UTSW 1 139753035 missense probably damaging 1.00
R4356:Gm4788 UTSW 1 139732310 missense probably damaging 1.00
R4747:Gm4788 UTSW 1 139698184 missense probably damaging 1.00
R4838:Gm4788 UTSW 1 139733443 missense probably damaging 1.00
R4867:Gm4788 UTSW 1 139774475 critical splice donor site probably null
R4910:Gm4788 UTSW 1 139774563 missense probably damaging 1.00
R4911:Gm4788 UTSW 1 139774563 missense probably damaging 1.00
R5050:Gm4788 UTSW 1 139736840 missense probably damaging 0.99
R5120:Gm4788 UTSW 1 139753103 missense probably benign 0.39
R5259:Gm4788 UTSW 1 139740495 missense probably damaging 1.00
R5504:Gm4788 UTSW 1 139701820 missense probably benign 0.18
R5825:Gm4788 UTSW 1 139774598 synonymous probably null
R5949:Gm4788 UTSW 1 139733149 missense probably damaging 0.98
R6140:Gm4788 UTSW 1 139732395 missense probably damaging 1.00
R6200:Gm4788 UTSW 1 139754335 missense probably damaging 0.97
R6254:Gm4788 UTSW 1 139754390 missense probably damaging 0.98
R6334:Gm4788 UTSW 1 139773924 unclassified probably null
R6611:Gm4788 UTSW 1 139732390 missense probably damaging 1.00
R6798:Gm4788 UTSW 1 139698121 missense probably benign 0.20
R6800:Gm4788 UTSW 1 139701981 missense possibly damaging 0.85
R6895:Gm4788 UTSW 1 139740472 missense possibly damaging 0.84
R6904:Gm4788 UTSW 1 139731653 missense possibly damaging 0.79
R6994:Gm4788 UTSW 1 139736930 missense possibly damaging 0.67
R7173:Gm4788 UTSW 1 139731677 nonsense probably null
R7184:Gm4788 UTSW 1 139733084 missense possibly damaging 0.65
R7192:Gm4788 UTSW 1 139739295 missense probably damaging 0.96
R7205:Gm4788 UTSW 1 139753050 nonsense probably null
R7302:Gm4788 UTSW 1 139739698 intron probably null
R7308:Gm4788 UTSW 1 139754303 missense possibly damaging 0.71
R7735:Gm4788 UTSW 1 139732301 critical splice donor site probably null
R8006:Gm4788 UTSW 1 139736852 missense probably damaging 1.00
R8045:Gm4788 UTSW 1 139733505 missense probably damaging 0.99
X0009:Gm4788 UTSW 1 139733549 missense probably benign 0.08
X0024:Gm4788 UTSW 1 139733509 missense probably damaging 1.00
Z1088:Gm4788 UTSW 1 139754261 missense probably damaging 0.99
Z1176:Gm4788 UTSW 1 139698256 missense probably benign 0.13
Z1176:Gm4788 UTSW 1 139733448 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCAATGTCTTAGAAAATGGTCC -3'
(R):5'- AACCCTTGGTATAGTTCCAGTTTTAAG -3'

Sequencing Primer
(F):5'- AGAAAATGGTCCTTTTTCGTAGG -3'
(R):5'- AGGAAGTAAATTGTTGTTGTTCTCC -3'
Posted On2018-02-28