Mutagenetix > Incidental Mutation

Incidental Mutation 'R6255:Fbxo18'

506033

Institutional Source

Beutler Lab

Gene Symbol

Fbxo18

Ensembl Gene

ENSMUSG00000058594

Gene Name

F-box protein 18

Synonyms

Fbx18

MMRRC Submission

044372-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.380) question?

Stock #

R6255 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

11742573-11777582 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 11748446 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 879 (F879L)

Ref Sequence

ENSEMBL: ENSMUSP00000071495 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071564] [ENSMUST00000131893]

AlphaFold

Q8K2I9

Predicted Effect

probably benign
Transcript: ENSMUST00000071564
AA Change: F879L

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000071495
Gene: ENSMUSG00000058594
AA Change: F879L

Domain	Start	End	E-Value	Type
FBOX	213	256	3.94e-3	SMART
Pfam:UvrD-helicase	626	692	8e-10	PFAM
Pfam:UvrD_C	862	935	1.7e-12	PFAM
Pfam:UvrD_C_2	867	931	1.6e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123717

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123723

Predicted Effect

probably benign
Transcript: ENSMUST00000131893
AA Change: F294L

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000116392
Gene: ENSMUSG00000058594
AA Change: F294L

Domain	Start	End	E-Value	Type
SCOP:d1pjr_1	63	141	5e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136633

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139292

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155604

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. It contains an F-box motif and seven conserved helicase motifs, and has both DNA-dependent ATPase and DNA unwinding activities. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	T	A	13: 119,466,123	V7E	possibly damaging	Het
Aars2	G	A	17: 45,514,609	G333S	probably damaging	Het
Aen	T	A	7: 78,905,844	I85N	probably damaging	Het
Ahnak	C	A	19: 9,008,025	H2224Q	possibly damaging	Het
Aldh18a1	C	T	19: 40,580,043	R41H	possibly damaging	Het
Bpifb9b	T	A	2: 154,309,364	W2R	probably damaging	Het
Caprin2	A	G	6: 148,877,892	I139T	probably benign	Het
Cdhr3	T	A	12: 33,053,475	N381I	probably damaging	Het
Cecr2	A	G	6: 120,758,050	Y721C	probably damaging	Het
Cherp	G	T	8: 72,470,881	A125D	probably damaging	Het
Cped1	G	A	6: 22,138,715		probably null	Het
Ctdp1	T	A	18: 80,459,297		probably null	Het
Cyp2c55	T	C	19: 39,018,667	I169T	probably benign	Het
Cyp4a31	T	C	4: 115,574,920	L418P	possibly damaging	Het
Efcab7	T	C	4: 99,829,390		probably benign	Het
Efcab8	T	C	2: 153,810,268	W466R	possibly damaging	Het
Ehd3	C	A	17: 73,805,413	N57K	probably benign	Het
Ern2	C	A	7: 122,173,272	K654N	probably damaging	Het
Gde1	T	C	7: 118,691,781	D92G	probably null	Het
Gm4788	A	T	1: 139,753,011	C256*	probably null	Het
Heatr5b	A	G	17: 78,803,434	V995A	probably damaging	Het
Ifrd2	A	G	9: 107,592,091	E346G	probably damaging	Het
Ism1	AACGGACCCGTTCTTGTGGCTATGCA	AA	2: 139,746,042		probably benign	Het
Itgb4	T	C	11: 115,998,137	V1102A	possibly damaging	Het
Itgb6	A	T	2: 60,605,276	I710N	probably damaging	Het
Kif1a	T	C	1: 93,019,983	K1578E	probably damaging	Het
Kif9	T	C	9: 110,517,834		probably null	Het
Kitl	T	C	10: 100,089,233	*57Q	probably null	Het
Lrat	C	A	3: 82,903,505	V70F	probably damaging	Het
Lrrc9	T	A	12: 72,487,023	M1022K	probably benign	Het
Muc16	T	C	9: 18,655,599	T1875A	unknown	Het
Mup4	T	A	4: 59,957,890	N171I	probably damaging	Het
Npas4	G	A	19: 4,986,375	T587I	probably damaging	Het
Oas3	A	G	5: 120,771,230	V217A	probably benign	Het
Olfr786	A	G	10: 129,437,688	N292S	possibly damaging	Het
Osbp	C	A	19: 11,977,953	A323D	possibly damaging	Het
Panx2	G	A	15: 89,067,618	R96H	probably damaging	Het
Pcdhb18	G	A	18: 37,490,484	R289Q	probably benign	Het
Piezo2	T	C	18: 63,121,270	R385G	possibly damaging	Het
Pkn2	T	C	3: 142,811,599	T476A	probably damaging	Het
Plekha4	T	C	7: 45,553,802		probably benign	Het
Ppfibp2	T	C	7: 107,681,762	S94P	probably damaging	Het
Pramel7	T	A	2: 87,489,663	I429L	probably benign	Het
Rif1	A	G	2: 52,085,053	K325E	probably damaging	Het
Ror2	T	C	13: 53,110,542	Y826C	probably damaging	Het
Rsph10b	G	A	5: 143,959,746	G19R	probably damaging	Het
Slc20a1	A	G	2: 129,208,004	N361D	probably damaging	Het
Slc26a9	A	G	1: 131,763,909	D630G	probably benign	Het
Smtnl2	G	A	11: 72,401,399	A274V	probably damaging	Het
Trank1	T	C	9: 111,352,246		probably null	Het
Tspan10	T	A	11: 120,444,542	C159*	probably null	Het
Uba6	G	A	5: 86,164,765	T23I	probably benign	Het
Vmn2r74	T	C	7: 85,952,451	T660A	possibly damaging	Het
Vwa5b1	T	C	4: 138,578,672	N905S	probably benign	Het
Zfp831	T	C	2: 174,646,421	L963P	possibly damaging	Het
Zfp990	T	A	4: 145,537,789	N452K	probably benign	Het

Other mutations in Fbxo18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01615:Fbxo18	APN	2	11757523	nonsense	probably null
IGL02081:Fbxo18	APN	2	11764127	missense	probably benign	0.31
IGL02082:Fbxo18	APN	2	11764127	missense	probably benign	0.31
IGL02084:Fbxo18	APN	2	11764127	missense	probably benign	0.31
IGL02086:Fbxo18	APN	2	11764127	missense	probably benign	0.31
IGL02369:Fbxo18	APN	2	11747158	missense	possibly damaging	0.61
IGL02584:Fbxo18	APN	2	11759958	missense	probably benign	0.07
IGL03138:Fbxo18	UTSW	2	11749509	intron	probably benign
R0384:Fbxo18	UTSW	2	11749578	missense	probably damaging	1.00
R0479:Fbxo18	UTSW	2	11758419	missense	probably damaging	1.00
R0972:Fbxo18	UTSW	2	11764088	splice site	probably benign
R1420:Fbxo18	UTSW	2	11767682	missense	probably benign	0.01
R1827:Fbxo18	UTSW	2	11763888	missense	possibly damaging	0.88
R1832:Fbxo18	UTSW	2	11767400	missense	probably benign	0.08
R1960:Fbxo18	UTSW	2	11757528	missense	probably damaging	0.98
R2040:Fbxo18	UTSW	2	11769895	missense	possibly damaging	0.66
R2044:Fbxo18	UTSW	2	11762970	missense	possibly damaging	0.89
R2102:Fbxo18	UTSW	2	11758289	missense	probably benign	0.18
R3236:Fbxo18	UTSW	2	11769826	missense	probably damaging	1.00
R3975:Fbxo18	UTSW	2	11767210	missense	possibly damaging	0.72
R4504:Fbxo18	UTSW	2	11749017	missense	possibly damaging	0.91
R4505:Fbxo18	UTSW	2	11749017	missense	possibly damaging	0.91
R4507:Fbxo18	UTSW	2	11749017	missense	possibly damaging	0.91
R4799:Fbxo18	UTSW	2	11755747	missense	probably damaging	1.00
R4894:Fbxo18	UTSW	2	11762960	missense	probably damaging	1.00
R4994:Fbxo18	UTSW	2	11764230	missense	probably damaging	1.00
R5579:Fbxo18	UTSW	2	11748993	missense	probably damaging	0.97
R5801:Fbxo18	UTSW	2	11769826	missense	probably damaging	1.00
R7011:Fbxo18	UTSW	2	11762963	missense	probably damaging	1.00
R7177:Fbxo18	UTSW	2	11755711	missense	probably damaging	1.00
R7243:Fbxo18	UTSW	2	11751525	missense	probably benign	0.11
R7331:Fbxo18	UTSW	2	11763986	missense	probably benign
R7361:Fbxo18	UTSW	2	11747076	missense	probably damaging	1.00
R7460:Fbxo18	UTSW	2	11756685	missense	probably benign	0.38
R7541:Fbxo18	UTSW	2	11749537	missense	probably benign	0.05
R8000:Fbxo18	UTSW	2	11767289	missense	probably benign	0.21
R8010:Fbxo18	UTSW	2	11767632	missense	probably benign	0.15
R8056:Fbxo18	UTSW	2	11743630	missense	probably benign	0.01
R8517:Fbxo18	UTSW	2	11777430	critical splice donor site	probably null
R8686:Fbxo18	UTSW	2	11755658	missense	probably benign	0.00
R8883:Fbxo18	UTSW	2	11749111	missense	probably benign	0.21
R9093:Fbxo18	UTSW	2	11759990	missense	probably damaging	1.00
R9306:Fbxo18	UTSW	2	11767576	missense	probably benign	0.00
R9342:Fbxo18	UTSW	2	11749603	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCTAGAACAGGAGGCCATTCTATC -3'
(R):5'- GGGCAGACTTGAATGGCATAC -3'

Sequencing Primer
(F):5'- AGGAGGCCATTCTATCCCATCG -3'
(R):5'- CAGACTTGAATGGCATACTTTGAGG -3'

Posted On

2018-02-28