Mutagenetix > Incidental Mutation

Incidental Mutation 'R6255:Rif1'

506034

Institutional Source

Beutler Lab

Gene Symbol

Rif1

Ensembl Gene

ENSMUSG00000036202

Gene Name

replication timing regulatory factor 1

Synonyms

D2Ertd145e, 6530403D07Rik, 5730435J01Rik

MMRRC Submission

044372-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6255 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

51962844-52012395 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 51975065 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 325 (K325E)

Ref Sequence

ENSEMBL: ENSMUSP00000108313 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069794] [ENSMUST00000112693]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000069794
AA Change: K325E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064155
Gene: ENSMUSG00000036202
AA Change: K325E

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	22	368	3.3e-78	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112693
AA Change: K325E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: K325E

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	18	381	1.4e-85	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145130

Meta Mutation Damage Score

0.1602

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	T	A	13: 119,602,659 (GRCm39)	V7E	possibly damaging	Het
Aars2	G	A	17: 45,825,535 (GRCm39)	G333S	probably damaging	Het
Aen	T	A	7: 78,555,592 (GRCm39)	I85N	probably damaging	Het
Ahnak	C	A	19: 8,985,389 (GRCm39)	H2224Q	possibly damaging	Het
Aldh18a1	C	T	19: 40,568,487 (GRCm39)	R41H	possibly damaging	Het
Bpifb9b	T	A	2: 154,151,284 (GRCm39)	W2R	probably damaging	Het
Caprin2	A	G	6: 148,779,390 (GRCm39)	I139T	probably benign	Het
Cdhr3	T	A	12: 33,103,474 (GRCm39)	N381I	probably damaging	Het
Cecr2	A	G	6: 120,735,011 (GRCm39)	Y721C	probably damaging	Het
Cfhr4	A	T	1: 139,680,749 (GRCm39)	C256*	probably null	Het
Cherp	G	T	8: 73,224,725 (GRCm39)	A125D	probably damaging	Het
Cped1	G	A	6: 22,138,714 (GRCm39)		probably null	Het
Ctdp1	T	A	18: 80,502,512 (GRCm39)		probably null	Het
Cyp2c55	T	C	19: 39,007,111 (GRCm39)	I169T	probably benign	Het
Cyp4a31	T	C	4: 115,432,117 (GRCm39)	L418P	possibly damaging	Het
Efcab7	T	C	4: 99,717,627 (GRCm39)		probably benign	Het
Efcab8	T	C	2: 153,652,188 (GRCm39)	W466R	possibly damaging	Het
Ehd3	C	A	17: 74,112,408 (GRCm39)	N57K	probably benign	Het
Ern2	C	A	7: 121,772,495 (GRCm39)	K654N	probably damaging	Het
Fbh1	A	T	2: 11,753,257 (GRCm39)	F879L	probably benign	Het
Gde1	T	C	7: 118,291,004 (GRCm39)	D92G	probably null	Het
Heatr5b	A	G	17: 79,110,863 (GRCm39)	V995A	probably damaging	Het
Ifrd2	A	G	9: 107,469,290 (GRCm39)	E346G	probably damaging	Het
Ism1	AACGGACCCGTTCTTGTGGCTATGCA	AA	2: 139,587,962 (GRCm39)		probably benign	Het
Itgb4	T	C	11: 115,888,963 (GRCm39)	V1102A	possibly damaging	Het
Itgb6	A	T	2: 60,435,620 (GRCm39)	I710N	probably damaging	Het
Kif1a	T	C	1: 92,947,705 (GRCm39)	K1578E	probably damaging	Het
Kif9	T	C	9: 110,346,902 (GRCm39)		probably null	Het
Kitl	T	C	10: 99,925,095 (GRCm39)	*57Q	probably null	Het
Lrat	C	A	3: 82,810,812 (GRCm39)	V70F	probably damaging	Het
Lrrc9	T	A	12: 72,533,797 (GRCm39)	M1022K	probably benign	Het
Muc16	T	C	9: 18,566,895 (GRCm39)	T1875A	unknown	Het
Mup4	T	A	4: 59,957,890 (GRCm39)	N171I	probably damaging	Het
Npas4	G	A	19: 5,036,403 (GRCm39)	T587I	probably damaging	Het
Oas3	A	G	5: 120,909,295 (GRCm39)	V217A	probably benign	Het
Or6c1b	A	G	10: 129,273,557 (GRCm39)	N292S	possibly damaging	Het
Osbp	C	A	19: 11,955,317 (GRCm39)	A323D	possibly damaging	Het
Panx2	G	A	15: 88,951,821 (GRCm39)	R96H	probably damaging	Het
Pcdhb18	G	A	18: 37,623,537 (GRCm39)	R289Q	probably benign	Het
Piezo2	T	C	18: 63,254,341 (GRCm39)	R385G	possibly damaging	Het
Pkn2	T	C	3: 142,517,360 (GRCm39)	T476A	probably damaging	Het
Plekha4	T	C	7: 45,203,226 (GRCm39)		probably benign	Het
Ppfibp2	T	C	7: 107,280,969 (GRCm39)	S94P	probably damaging	Het
Pramel7	T	A	2: 87,320,007 (GRCm39)	I429L	probably benign	Het
Ror2	T	C	13: 53,264,578 (GRCm39)	Y826C	probably damaging	Het
Rsph10b	G	A	5: 143,896,564 (GRCm39)	G19R	probably damaging	Het
Slc20a1	A	G	2: 129,049,924 (GRCm39)	N361D	probably damaging	Het
Slc26a9	A	G	1: 131,691,647 (GRCm39)	D630G	probably benign	Het
Smtnl2	G	A	11: 72,292,225 (GRCm39)	A274V	probably damaging	Het
Trank1	T	C	9: 111,181,314 (GRCm39)		probably null	Het
Tspan10	T	A	11: 120,335,368 (GRCm39)	C159*	probably null	Het
Uba6	G	A	5: 86,312,624 (GRCm39)	T23I	probably benign	Het
Vmn2r74	T	C	7: 85,601,659 (GRCm39)	T660A	possibly damaging	Het
Vwa5b1	T	C	4: 138,305,983 (GRCm39)	N905S	probably benign	Het
Zfp831	T	C	2: 174,488,214 (GRCm39)	L963P	possibly damaging	Het
Zfp990	T	A	4: 145,264,359 (GRCm39)	N452K	probably benign	Het

Other mutations in Rif1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Rif1	APN	2	52,011,019 (GRCm39)	missense	probably damaging	0.96
IGL00711:Rif1	APN	2	52,001,082 (GRCm39)	missense	probably benign	0.00
IGL00721:Rif1	APN	2	52,009,129 (GRCm39)	missense	probably damaging	1.00
IGL01085:Rif1	APN	2	51,975,152 (GRCm39)	missense	possibly damaging	0.71
IGL01093:Rif1	APN	2	51,985,960 (GRCm39)	missense	probably damaging	1.00
IGL01107:Rif1	APN	2	52,001,315 (GRCm39)	missense	probably benign	0.00
IGL01138:Rif1	APN	2	52,001,534 (GRCm39)	missense	probably damaging	1.00
IGL01844:Rif1	APN	2	52,002,555 (GRCm39)	missense	probably benign	0.07
IGL02441:Rif1	APN	2	51,995,527 (GRCm39)	missense	probably benign	0.00
IGL02448:Rif1	APN	2	52,006,708 (GRCm39)	missense	probably damaging	0.99
IGL02563:Rif1	APN	2	51,967,077 (GRCm39)	missense	probably damaging	1.00
IGL02704:Rif1	APN	2	51,983,588 (GRCm39)	missense	probably damaging	1.00
IGL02946:Rif1	APN	2	52,000,137 (GRCm39)	nonsense	probably null
IGL03060:Rif1	APN	2	52,002,149 (GRCm39)	missense	probably damaging	0.97
IGL03206:Rif1	APN	2	51,993,634 (GRCm39)	missense	probably damaging	1.00
IGL03263:Rif1	APN	2	51,980,273 (GRCm39)	missense	probably damaging	0.99
IGL03267:Rif1	APN	2	51,967,000 (GRCm39)	missense	possibly damaging	0.94
IGL03280:Rif1	APN	2	52,002,611 (GRCm39)	missense	probably benign	0.32
hifi	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
nietzsche	UTSW	2	51,967,032 (GRCm39)	missense	probably benign	0.08
PIT4305001:Rif1	UTSW	2	52,001,970 (GRCm39)	missense
R0017:Rif1	UTSW	2	52,006,686 (GRCm39)	missense	probably benign	0.18
R0017:Rif1	UTSW	2	52,006,686 (GRCm39)	missense	probably benign	0.18
R0060:Rif1	UTSW	2	52,001,129 (GRCm39)	missense	probably damaging	1.00
R0060:Rif1	UTSW	2	52,001,129 (GRCm39)	missense	probably damaging	1.00
R0104:Rif1	UTSW	2	52,000,104 (GRCm39)	missense	possibly damaging	0.77
R0268:Rif1	UTSW	2	51,980,298 (GRCm39)	critical splice donor site	probably null
R0276:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0278:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0288:Rif1	UTSW	2	52,000,025 (GRCm39)	missense	probably damaging	1.00
R0314:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0345:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0346:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0383:Rif1	UTSW	2	51,975,153 (GRCm39)	missense	probably damaging	0.96
R0384:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0387:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0388:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0456:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0477:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0505:Rif1	UTSW	2	52,000,749 (GRCm39)	missense	probably damaging	0.99
R0510:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0511:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0512:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0633:Rif1	UTSW	2	52,002,575 (GRCm39)	missense	probably benign	0.00
R0637:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0638:Rif1	UTSW	2	52,001,600 (GRCm39)	missense	probably benign	0.12
R0666:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0675:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0707:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0726:Rif1	UTSW	2	52,000,365 (GRCm39)	missense	possibly damaging	0.52
R0743:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0744:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0938:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0939:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0940:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0941:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0942:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0943:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1006:Rif1	UTSW	2	51,975,041 (GRCm39)	missense	probably damaging	0.99
R1052:Rif1	UTSW	2	52,001,574 (GRCm39)	missense	probably benign	0.01
R1061:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1175:Rif1	UTSW	2	51,997,640 (GRCm39)	unclassified	probably benign
R1183:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1184:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1271:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1332:Rif1	UTSW	2	51,968,326 (GRCm39)	missense	probably benign	0.06
R1336:Rif1	UTSW	2	51,968,326 (GRCm39)	missense	probably benign	0.06
R1351:Rif1	UTSW	2	52,001,567 (GRCm39)	missense	possibly damaging	0.74
R1517:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1527:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1560:Rif1	UTSW	2	52,001,143 (GRCm39)	missense	probably damaging	1.00
R1563:Rif1	UTSW	2	51,963,235 (GRCm39)	missense	probably damaging	0.99
R1571:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1625:Rif1	UTSW	2	51,993,652 (GRCm39)	missense	probably benign	0.25
R1679:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1689:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1731:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1744:Rif1	UTSW	2	52,002,404 (GRCm39)	missense	possibly damaging	0.56
R1746:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1748:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1831:Rif1	UTSW	2	51,968,507 (GRCm39)	nonsense	probably null
R1902:Rif1	UTSW	2	52,006,685 (GRCm39)	missense	possibly damaging	0.93
R1964:Rif1	UTSW	2	51,988,421 (GRCm39)	missense	probably benign	0.01
R1978:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2000:Rif1	UTSW	2	51,971,310 (GRCm39)	missense	probably damaging	0.99
R2030:Rif1	UTSW	2	51,982,358 (GRCm39)	missense	probably damaging	1.00
R2056:Rif1	UTSW	2	51,983,588 (GRCm39)	missense	probably damaging	1.00
R2106:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2109:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2125:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2126:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2145:Rif1	UTSW	2	52,001,412 (GRCm39)	missense	possibly damaging	0.63
R2152:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2153:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2213:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2327:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2512:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2513:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2516:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2520:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2905:Rif1	UTSW	2	51,988,516 (GRCm39)	missense	probably damaging	0.99
R3005:Rif1	UTSW	2	51,972,776 (GRCm39)	missense	probably damaging	1.00
R3155:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R3156:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R3429:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R3707:Rif1	UTSW	2	51,983,592 (GRCm39)	missense	probably damaging	1.00
R3907:Rif1	UTSW	2	52,002,557 (GRCm39)	missense	probably benign	0.03
R3978:Rif1	UTSW	2	52,006,759 (GRCm39)	critical splice donor site	probably null
R4023:Rif1	UTSW	2	52,011,099 (GRCm39)	missense	probably benign	0.01
R4052:Rif1	UTSW	2	51,988,483 (GRCm39)	nonsense	probably null
R4668:Rif1	UTSW	2	52,001,964 (GRCm39)	missense	probably benign	0.01
R4674:Rif1	UTSW	2	51,996,954 (GRCm39)	missense	probably null	1.00
R4715:Rif1	UTSW	2	51,963,151 (GRCm39)	utr 5 prime	probably benign
R4766:Rif1	UTSW	2	51,988,946 (GRCm39)	missense	probably damaging	1.00
R4783:Rif1	UTSW	2	52,002,759 (GRCm39)	missense	probably damaging	0.96
R4785:Rif1	UTSW	2	52,002,759 (GRCm39)	missense	probably damaging	0.96
R4869:Rif1	UTSW	2	51,983,623 (GRCm39)	intron	probably benign
R4911:Rif1	UTSW	2	52,000,530 (GRCm39)	missense	probably damaging	0.98
R4951:Rif1	UTSW	2	51,974,998 (GRCm39)	splice site	probably null
R5044:Rif1	UTSW	2	51,999,940 (GRCm39)	missense	probably damaging	0.99
R5088:Rif1	UTSW	2	51,982,307 (GRCm39)	missense	possibly damaging	0.91
R5151:Rif1	UTSW	2	52,010,321 (GRCm39)	missense	probably damaging	1.00
R5187:Rif1	UTSW	2	51,971,301 (GRCm39)	missense	probably damaging	1.00
R5222:Rif1	UTSW	2	51,967,032 (GRCm39)	missense	probably benign	0.08
R5243:Rif1	UTSW	2	52,001,836 (GRCm39)	missense	possibly damaging	0.86
R5436:Rif1	UTSW	2	52,010,983 (GRCm39)	intron	probably benign
R5476:Rif1	UTSW	2	51,979,607 (GRCm39)	missense	probably damaging	1.00
R5496:Rif1	UTSW	2	51,988,928 (GRCm39)	missense	probably damaging	1.00
R5641:Rif1	UTSW	2	52,011,170 (GRCm39)	missense	possibly damaging	0.80
R5883:Rif1	UTSW	2	51,995,651 (GRCm39)	critical splice donor site	probably null
R5987:Rif1	UTSW	2	51,985,856 (GRCm39)	missense	probably damaging	1.00
R5990:Rif1	UTSW	2	51,985,856 (GRCm39)	missense	probably damaging	1.00
R5992:Rif1	UTSW	2	51,985,856 (GRCm39)	missense	probably damaging	1.00
R6019:Rif1	UTSW	2	51,985,856 (GRCm39)	missense	probably damaging	1.00
R6020:Rif1	UTSW	2	51,985,856 (GRCm39)	missense	probably damaging	1.00
R6342:Rif1	UTSW	2	52,009,168 (GRCm39)	missense	probably damaging	0.97
R6364:Rif1	UTSW	2	51,997,681 (GRCm39)	missense	probably damaging	0.97
R6747:Rif1	UTSW	2	51,968,275 (GRCm39)	splice site	probably null
R6928:Rif1	UTSW	2	51,985,973 (GRCm39)	missense	probably damaging	1.00
R6954:Rif1	UTSW	2	52,002,703 (GRCm39)	missense	probably benign	0.00
R7003:Rif1	UTSW	2	51,967,001 (GRCm39)	missense	probably benign	0.06
R7310:Rif1	UTSW	2	51,995,631 (GRCm39)	missense	probably benign	0.12
R7549:Rif1	UTSW	2	51,968,519 (GRCm39)	missense	possibly damaging	0.52
R7603:Rif1	UTSW	2	51,966,187 (GRCm39)	missense	probably damaging	1.00
R7673:Rif1	UTSW	2	51,978,666 (GRCm39)	missense	probably damaging	1.00
R7741:Rif1	UTSW	2	51,975,153 (GRCm39)	missense	probably damaging	0.96
R7777:Rif1	UTSW	2	52,006,368 (GRCm39)	missense	probably benign	0.00
R7910:Rif1	UTSW	2	51,968,399 (GRCm39)	nonsense	probably null
R7962:Rif1	UTSW	2	51,964,288 (GRCm39)	missense	probably damaging	1.00
R8264:Rif1	UTSW	2	51,980,290 (GRCm39)	missense	noncoding transcript
R8390:Rif1	UTSW	2	52,000,935 (GRCm39)	missense	probably damaging	1.00
R8479:Rif1	UTSW	2	52,002,563 (GRCm39)	missense	possibly damaging	0.52
R8490:Rif1	UTSW	2	52,001,011 (GRCm39)	missense	probably damaging	0.96
R8762:Rif1	UTSW	2	52,001,742 (GRCm39)	missense
R8785:Rif1	UTSW	2	52,000,493 (GRCm39)	missense	probably benign	0.06
R8890:Rif1	UTSW	2	51,988,875 (GRCm39)	missense	probably damaging	0.99
R9081:Rif1	UTSW	2	52,000,989 (GRCm39)	missense	probably damaging	0.99
R9225:Rif1	UTSW	2	52,001,862 (GRCm39)	missense	probably benign	0.22
R9284:Rif1	UTSW	2	51,998,564 (GRCm39)	missense	probably benign	0.00
R9300:Rif1	UTSW	2	52,001,151 (GRCm39)	missense	probably damaging	1.00
R9366:Rif1	UTSW	2	52,010,356 (GRCm39)	missense
R9477:Rif1	UTSW	2	52,001,342 (GRCm39)	missense	probably benign	0.02
R9522:Rif1	UTSW	2	51,971,311 (GRCm39)	missense	probably damaging	1.00
R9573:Rif1	UTSW	2	52,000,466 (GRCm39)	missense	probably benign	0.29
R9630:Rif1	UTSW	2	51,979,607 (GRCm39)	missense	probably damaging	1.00
X0064:Rif1	UTSW	2	51,984,645 (GRCm39)	missense	probably damaging	0.96
X0064:Rif1	UTSW	2	51,964,327 (GRCm39)	missense	probably benign	0.00
Z1177:Rif1	UTSW	2	51,978,660 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTGGGAATAGTAACCCTTTTATG -3'
(R):5'- ATTAGACTGGTAAGGATTCAAGGACAC -3'

Sequencing Primer
(F):5'- CTGGTTTTGGCCCAGTTA -3'
(R):5'- TTTGAGGCCAGCAGAATATCC -3'

Posted On

2018-02-28