Incidental Mutation 'R6255:Slc20a1'
ID506037
Institutional Source Beutler Lab
Gene Symbol Slc20a1
Ensembl Gene ENSMUSG00000027397
Gene Namesolute carrier family 20, member 1
SynonymsPiT-1, Glvr1, Glvr-1
MMRRC Submission 044372-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6255 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location129198764-129211616 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129208004 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 361 (N361D)
Ref Sequence ENSEMBL: ENSMUSP00000105944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028880] [ENSMUST00000110315]
Predicted Effect probably damaging
Transcript: ENSMUST00000028880
AA Change: N361D

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028880
Gene: ENSMUSG00000027397
AA Change: N361D

DomainStartEndE-ValueType
Pfam:PHO4 43 667 1.8e-162 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110315
AA Change: N361D

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105944
Gene: ENSMUSG00000027397
AA Change: N361D

DomainStartEndE-ValueType
Pfam:PHO4 43 667 1.3e-132 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144025
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-phosphate symporter that absorbs phosphate from interstitial fluid for use in cellular functions such as metabolism, signal transduction, and nucleic acid and lipid synthesis. The encoded protein is also a retroviral receptor, causing human cells to be susceptible to infection by gibbon ape leukemia virus, simian sarcoma-associated virus, feline leukemia virus subgroup B, and 10A1 murine leukemia virus.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit mid-gestation lethality associated with abnormal vitelline vasculature, growth retardation, and anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,123 V7E possibly damaging Het
Aars2 G A 17: 45,514,609 G333S probably damaging Het
Aen T A 7: 78,905,844 I85N probably damaging Het
Ahnak C A 19: 9,008,025 H2224Q possibly damaging Het
Aldh18a1 C T 19: 40,580,043 R41H possibly damaging Het
Bpifb9b T A 2: 154,309,364 W2R probably damaging Het
Caprin2 A G 6: 148,877,892 I139T probably benign Het
Cdhr3 T A 12: 33,053,475 N381I probably damaging Het
Cecr2 A G 6: 120,758,050 Y721C probably damaging Het
Cherp G T 8: 72,470,881 A125D probably damaging Het
Cped1 G A 6: 22,138,715 probably null Het
Ctdp1 T A 18: 80,459,297 probably null Het
Cyp2c55 T C 19: 39,018,667 I169T probably benign Het
Cyp4a31 T C 4: 115,574,920 L418P possibly damaging Het
Efcab7 T C 4: 99,829,390 probably benign Het
Efcab8 T C 2: 153,810,268 W466R possibly damaging Het
Ehd3 C A 17: 73,805,413 N57K probably benign Het
Ern2 C A 7: 122,173,272 K654N probably damaging Het
Fbxo18 A T 2: 11,748,446 F879L probably benign Het
Gde1 T C 7: 118,691,781 D92G probably null Het
Gm4788 A T 1: 139,753,011 C256* probably null Het
Heatr5b A G 17: 78,803,434 V995A probably damaging Het
Ifrd2 A G 9: 107,592,091 E346G probably damaging Het
Ism1 AACGGACCCGTTCTTGTGGCTATGCA AA 2: 139,746,042 probably benign Het
Itgb4 T C 11: 115,998,137 V1102A possibly damaging Het
Itgb6 A T 2: 60,605,276 I710N probably damaging Het
Kif1a T C 1: 93,019,983 K1578E probably damaging Het
Kif9 T C 9: 110,517,834 probably null Het
Kitl T C 10: 100,089,233 *57Q probably null Het
Lrat C A 3: 82,903,505 V70F probably damaging Het
Lrrc9 T A 12: 72,487,023 M1022K probably benign Het
Muc16 T C 9: 18,655,599 T1875A unknown Het
Mup4 T A 4: 59,957,890 N171I probably damaging Het
Npas4 G A 19: 4,986,375 T587I probably damaging Het
Oas3 A G 5: 120,771,230 V217A probably benign Het
Olfr786 A G 10: 129,437,688 N292S possibly damaging Het
Osbp C A 19: 11,977,953 A323D possibly damaging Het
Panx2 G A 15: 89,067,618 R96H probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Piezo2 T C 18: 63,121,270 R385G possibly damaging Het
Pkn2 T C 3: 142,811,599 T476A probably damaging Het
Plekha4 T C 7: 45,553,802 probably benign Het
Ppfibp2 T C 7: 107,681,762 S94P probably damaging Het
Pramel7 T A 2: 87,489,663 I429L probably benign Het
Rif1 A G 2: 52,085,053 K325E probably damaging Het
Ror2 T C 13: 53,110,542 Y826C probably damaging Het
Rsph10b G A 5: 143,959,746 G19R probably damaging Het
Slc26a9 A G 1: 131,763,909 D630G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Trank1 T C 9: 111,352,246 probably null Het
Tspan10 T A 11: 120,444,542 C159* probably null Het
Uba6 G A 5: 86,164,765 T23I probably benign Het
Vmn2r74 T C 7: 85,952,451 T660A possibly damaging Het
Vwa5b1 T C 4: 138,578,672 N905S probably benign Het
Zfp831 T C 2: 174,646,421 L963P possibly damaging Het
Zfp990 T A 4: 145,537,789 N452K probably benign Het
Other mutations in Slc20a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01590:Slc20a1 APN 2 129209226 splice site probably benign
IGL02563:Slc20a1 APN 2 129207684 missense probably benign
R0037:Slc20a1 UTSW 2 129210772 missense probably damaging 1.00
R0514:Slc20a1 UTSW 2 129199891 missense probably damaging 1.00
R1221:Slc20a1 UTSW 2 129208404 missense probably benign 0.44
R2099:Slc20a1 UTSW 2 129207838 missense probably benign 0.00
R2122:Slc20a1 UTSW 2 129199819 missense possibly damaging 0.86
R2261:Slc20a1 UTSW 2 129206474 missense possibly damaging 0.85
R2426:Slc20a1 UTSW 2 129208230 missense probably benign 0.13
R3428:Slc20a1 UTSW 2 129200282 missense probably benign
R4712:Slc20a1 UTSW 2 129199691 splice site probably benign
R4981:Slc20a1 UTSW 2 129199999 missense probably damaging 1.00
R5213:Slc20a1 UTSW 2 129200509 missense probably damaging 1.00
R5395:Slc20a1 UTSW 2 129208337 missense probably damaging 1.00
R5506:Slc20a1 UTSW 2 129210819 missense probably benign 0.00
R6266:Slc20a1 UTSW 2 129209894 missense possibly damaging 0.78
R7022:Slc20a1 UTSW 2 129200059 missense probably damaging 0.99
R7091:Slc20a1 UTSW 2 129208272 missense possibly damaging 0.85
R7175:Slc20a1 UTSW 2 129210742 missense probably damaging 1.00
R7250:Slc20a1 UTSW 2 129209924 missense possibly damaging 0.78
X0067:Slc20a1 UTSW 2 129199888 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACGGTGTCATTCAAACTTGG -3'
(R):5'- TTGCGTCTCAAGGGCTTGTC -3'

Sequencing Primer
(F):5'- CATTCAAACTTGGTGACCTGGAG -3'
(R):5'- GGCTTGTCCCCAGAATCTC -3'
Posted On2018-02-28