Incidental Mutation 'R6255:Pkn2'
ID 506043
Institutional Source Beutler Lab
Gene Symbol Pkn2
Ensembl Gene ENSMUSG00000004591
Gene Name protein kinase N2
Synonyms PRK2, Stk7, Prkcl2, 6030436C20Rik
MMRRC Submission 044372-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6255 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 142790902-142882004 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 142811599 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 476 (T476A)
Ref Sequence ENSEMBL: ENSMUSP00000039566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043812] [ENSMUST00000173830] [ENSMUST00000173913] [ENSMUST00000174422]
AlphaFold Q8BWW9
Predicted Effect probably damaging
Transcript: ENSMUST00000043812
AA Change: T476A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039566
Gene: ENSMUSG00000004591
AA Change: T476A

DomainStartEndE-ValueType
Hr1 47 110 3.61e-20 SMART
Hr1 136 204 6.1e-18 SMART
Hr1 217 285 6.05e-22 SMART
C2 329 462 2.72e-8 SMART
low complexity region 535 546 N/A INTRINSIC
low complexity region 570 578 N/A INTRINSIC
S_TKc 656 915 7.94e-100 SMART
S_TK_X 916 980 6.77e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172521
Predicted Effect probably benign
Transcript: ENSMUST00000173615
Predicted Effect possibly damaging
Transcript: ENSMUST00000173830
AA Change: T428A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133691
Gene: ENSMUSG00000004591
AA Change: T428A

DomainStartEndE-ValueType
Hr1 47 110 3.61e-20 SMART
Hr1 136 204 6.1e-18 SMART
Hr1 217 285 6.05e-22 SMART
low complexity region 364 380 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 522 530 N/A INTRINSIC
S_TKc 608 867 7.94e-100 SMART
S_TK_X 868 932 6.77e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174169
Predicted Effect possibly damaging
Transcript: ENSMUST00000174422
AA Change: T460A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134559
Gene: ENSMUSG00000004591
AA Change: T460A

DomainStartEndE-ValueType
Hr1 47 110 3.61e-20 SMART
Hr1 136 204 6.1e-18 SMART
Hr1 217 285 6.05e-22 SMART
C2 329 446 2.92e-8 SMART
low complexity region 519 530 N/A INTRINSIC
low complexity region 554 562 N/A INTRINSIC
S_TKc 640 899 7.94e-100 SMART
S_TK_X 900 964 6.77e-16 SMART
Predicted Effect unknown
Transcript: ENSMUST00000174680
AA Change: T195A
SMART Domains Protein: ENSMUSP00000134041
Gene: ENSMUSG00000004591
AA Change: T195A

DomainStartEndE-ValueType
Hr1 1 67 1.33e-18 SMART
C2 72 182 3.51e-2 SMART
Meta Mutation Damage Score 0.1553 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display embryonic lethality during organogenesis with impaired mesenchymal cell proliferation and neural crest cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,123 V7E possibly damaging Het
Aars2 G A 17: 45,514,609 G333S probably damaging Het
Aen T A 7: 78,905,844 I85N probably damaging Het
Ahnak C A 19: 9,008,025 H2224Q possibly damaging Het
Aldh18a1 C T 19: 40,580,043 R41H possibly damaging Het
Bpifb9b T A 2: 154,309,364 W2R probably damaging Het
Caprin2 A G 6: 148,877,892 I139T probably benign Het
Cdhr3 T A 12: 33,053,475 N381I probably damaging Het
Cecr2 A G 6: 120,758,050 Y721C probably damaging Het
Cherp G T 8: 72,470,881 A125D probably damaging Het
Cped1 G A 6: 22,138,715 probably null Het
Ctdp1 T A 18: 80,459,297 probably null Het
Cyp2c55 T C 19: 39,018,667 I169T probably benign Het
Cyp4a31 T C 4: 115,574,920 L418P possibly damaging Het
Efcab7 T C 4: 99,829,390 probably benign Het
Efcab8 T C 2: 153,810,268 W466R possibly damaging Het
Ehd3 C A 17: 73,805,413 N57K probably benign Het
Ern2 C A 7: 122,173,272 K654N probably damaging Het
Fbxo18 A T 2: 11,748,446 F879L probably benign Het
Gde1 T C 7: 118,691,781 D92G probably null Het
Gm4788 A T 1: 139,753,011 C256* probably null Het
Heatr5b A G 17: 78,803,434 V995A probably damaging Het
Ifrd2 A G 9: 107,592,091 E346G probably damaging Het
Ism1 AACGGACCCGTTCTTGTGGCTATGCA AA 2: 139,746,042 probably benign Het
Itgb4 T C 11: 115,998,137 V1102A possibly damaging Het
Itgb6 A T 2: 60,605,276 I710N probably damaging Het
Kif1a T C 1: 93,019,983 K1578E probably damaging Het
Kif9 T C 9: 110,517,834 probably null Het
Kitl T C 10: 100,089,233 *57Q probably null Het
Lrat C A 3: 82,903,505 V70F probably damaging Het
Lrrc9 T A 12: 72,487,023 M1022K probably benign Het
Muc16 T C 9: 18,655,599 T1875A unknown Het
Mup4 T A 4: 59,957,890 N171I probably damaging Het
Npas4 G A 19: 4,986,375 T587I probably damaging Het
Oas3 A G 5: 120,771,230 V217A probably benign Het
Olfr786 A G 10: 129,437,688 N292S possibly damaging Het
Osbp C A 19: 11,977,953 A323D possibly damaging Het
Panx2 G A 15: 89,067,618 R96H probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Piezo2 T C 18: 63,121,270 R385G possibly damaging Het
Plekha4 T C 7: 45,553,802 probably benign Het
Ppfibp2 T C 7: 107,681,762 S94P probably damaging Het
Pramel7 T A 2: 87,489,663 I429L probably benign Het
Rif1 A G 2: 52,085,053 K325E probably damaging Het
Ror2 T C 13: 53,110,542 Y826C probably damaging Het
Rsph10b G A 5: 143,959,746 G19R probably damaging Het
Slc20a1 A G 2: 129,208,004 N361D probably damaging Het
Slc26a9 A G 1: 131,763,909 D630G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Trank1 T C 9: 111,352,246 probably null Het
Tspan10 T A 11: 120,444,542 C159* probably null Het
Uba6 G A 5: 86,164,765 T23I probably benign Het
Vmn2r74 T C 7: 85,952,451 T660A possibly damaging Het
Vwa5b1 T C 4: 138,578,672 N905S probably benign Het
Zfp831 T C 2: 174,646,421 L963P possibly damaging Het
Zfp990 T A 4: 145,537,789 N452K probably benign Het
Other mutations in Pkn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Pkn2 APN 3 142799019 missense probably damaging 1.00
IGL00852:Pkn2 APN 3 142809816 unclassified probably benign
IGL00917:Pkn2 APN 3 142853625 missense probably damaging 1.00
IGL01147:Pkn2 APN 3 142829009 missense probably benign 0.06
IGL01556:Pkn2 APN 3 142829317 missense possibly damaging 0.88
IGL01574:Pkn2 APN 3 142839231 missense possibly damaging 0.48
IGL02058:Pkn2 APN 3 142803663 missense probably damaging 0.97
IGL02136:Pkn2 APN 3 142853590 missense probably damaging 1.00
IGL02310:Pkn2 APN 3 142811580 missense probably damaging 1.00
IGL02540:Pkn2 APN 3 142809704 missense probably benign 0.01
IGL02607:Pkn2 APN 3 142794101 critical splice donor site probably null
IGL03256:Pkn2 APN 3 142803550 splice site probably null
voodoo UTSW 3 142853538 missense possibly damaging 0.78
R0001:Pkn2 UTSW 3 142828988 missense probably benign 0.00
R0048:Pkn2 UTSW 3 142810827 missense probably damaging 1.00
R0081:Pkn2 UTSW 3 142853582 missense probably damaging 1.00
R0514:Pkn2 UTSW 3 142810458 missense possibly damaging 0.76
R0670:Pkn2 UTSW 3 142839343 missense probably damaging 0.99
R0709:Pkn2 UTSW 3 142830520 missense probably damaging 0.98
R1025:Pkn2 UTSW 3 142821565 critical splice donor site probably null
R1190:Pkn2 UTSW 3 142811525 critical splice donor site probably null
R1602:Pkn2 UTSW 3 142853538 missense possibly damaging 0.78
R1729:Pkn2 UTSW 3 142810701 missense probably benign 0.00
R1756:Pkn2 UTSW 3 142810727 missense possibly damaging 0.94
R1764:Pkn2 UTSW 3 142793854 missense probably damaging 1.00
R1797:Pkn2 UTSW 3 142809528 missense probably damaging 1.00
R1833:Pkn2 UTSW 3 142821647 missense probably damaging 1.00
R2035:Pkn2 UTSW 3 142820587 missense probably damaging 0.99
R2058:Pkn2 UTSW 3 142853471 missense possibly damaging 0.93
R3779:Pkn2 UTSW 3 142793980 missense possibly damaging 0.89
R3940:Pkn2 UTSW 3 142793911 missense probably damaging 1.00
R3967:Pkn2 UTSW 3 142809677 missense probably damaging 0.98
R4008:Pkn2 UTSW 3 142810458 missense possibly damaging 0.76
R4160:Pkn2 UTSW 3 142803564 missense probably benign 0.42
R4222:Pkn2 UTSW 3 142793866 nonsense probably null
R4243:Pkn2 UTSW 3 142820578 missense possibly damaging 0.64
R4380:Pkn2 UTSW 3 142830456 unclassified probably benign
R4826:Pkn2 UTSW 3 142809509 missense probably damaging 1.00
R4869:Pkn2 UTSW 3 142803618 missense probably damaging 1.00
R5096:Pkn2 UTSW 3 142839331 missense probably damaging 0.99
R5175:Pkn2 UTSW 3 142798923 missense probably damaging 1.00
R5301:Pkn2 UTSW 3 142839206 critical splice donor site probably null
R5839:Pkn2 UTSW 3 142821529 missense probably benign 0.02
R6155:Pkn2 UTSW 3 142853693 missense probably benign 0.00
R6198:Pkn2 UTSW 3 142810404 missense probably benign 0.00
R6293:Pkn2 UTSW 3 142809704 missense probably benign 0.15
R6494:Pkn2 UTSW 3 142803668 missense possibly damaging 0.94
R6659:Pkn2 UTSW 3 142803587 missense probably damaging 1.00
R6809:Pkn2 UTSW 3 142799004 missense probably damaging 1.00
R7267:Pkn2 UTSW 3 142812015 missense possibly damaging 0.90
R7367:Pkn2 UTSW 3 142810727 missense probably benign 0.00
R7746:Pkn2 UTSW 3 142794107 missense probably damaging 1.00
R7940:Pkn2 UTSW 3 142810719 missense probably benign 0.00
R8324:Pkn2 UTSW 3 142829010 missense probably benign 0.15
R8847:Pkn2 UTSW 3 142820640 missense probably benign 0.29
R8947:Pkn2 UTSW 3 142811913 critical splice donor site probably null
R9096:Pkn2 UTSW 3 142809488 missense probably benign 0.03
R9097:Pkn2 UTSW 3 142809488 missense probably benign 0.03
R9130:Pkn2 UTSW 3 142809484 missense possibly damaging 0.51
R9226:Pkn2 UTSW 3 142793948 missense probably damaging 1.00
R9267:Pkn2 UTSW 3 142811915 missense probably null 0.97
R9277:Pkn2 UTSW 3 142810748 missense probably benign 0.01
R9308:Pkn2 UTSW 3 142811963 missense probably benign 0.21
R9372:Pkn2 UTSW 3 142829257 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCACTTAAGGACGTGTTTCAGTC -3'
(R):5'- CACAGGGTACTTTGTTTGCAGAG -3'

Sequencing Primer
(F):5'- GTTTCAGTCCTCATTTAAAAATGGC -3'
(R):5'- CACTGCTGCATAAGGACGTGAC -3'
Posted On 2018-02-28