Incidental Mutation 'R6255:Efcab7'
ID 506045
Institutional Source Beutler Lab
Gene Symbol Efcab7
Ensembl Gene ENSMUSG00000073791
Gene Name EF-hand calcium binding domain 7
MMRRC Submission 044372-MU
Accession Numbers

Genbank: NM_145549; MGI: 2385199

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6255 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 99829198-99912788 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 99829390 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097959] [ENSMUST00000106994] [ENSMUST00000124547] [ENSMUST00000143994] [ENSMUST00000146258]
AlphaFold Q8VDY4
Predicted Effect probably benign
Transcript: ENSMUST00000097959
SMART Domains Protein: ENSMUSP00000095572
Gene: ENSMUSG00000073791

low complexity region 85 99 N/A INTRINSIC
SCOP:d2pvba_ 339 408 2e-4 SMART
Blast:EFh 348 376 2e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102786
Predicted Effect probably benign
Transcript: ENSMUST00000106994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123830
Predicted Effect probably benign
Transcript: ENSMUST00000124547
Predicted Effect unknown
Transcript: ENSMUST00000143994
AA Change: W15R
Predicted Effect probably benign
Transcript: ENSMUST00000146258
SMART Domains Protein: ENSMUSP00000117153
Gene: ENSMUSG00000028549

Pfam:CENP-R 25 162 1e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146739
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,123 V7E possibly damaging Het
Aars2 G A 17: 45,514,609 G333S probably damaging Het
Aen T A 7: 78,905,844 I85N probably damaging Het
Ahnak C A 19: 9,008,025 H2224Q possibly damaging Het
Aldh18a1 C T 19: 40,580,043 R41H possibly damaging Het
Bpifb9b T A 2: 154,309,364 W2R probably damaging Het
Caprin2 A G 6: 148,877,892 I139T probably benign Het
Cdhr3 T A 12: 33,053,475 N381I probably damaging Het
Cecr2 A G 6: 120,758,050 Y721C probably damaging Het
Cherp G T 8: 72,470,881 A125D probably damaging Het
Cped1 G A 6: 22,138,715 probably null Het
Ctdp1 T A 18: 80,459,297 probably null Het
Cyp2c55 T C 19: 39,018,667 I169T probably benign Het
Cyp4a31 T C 4: 115,574,920 L418P possibly damaging Het
Efcab8 T C 2: 153,810,268 W466R possibly damaging Het
Ehd3 C A 17: 73,805,413 N57K probably benign Het
Ern2 C A 7: 122,173,272 K654N probably damaging Het
Fbxo18 A T 2: 11,748,446 F879L probably benign Het
Gde1 T C 7: 118,691,781 D92G probably null Het
Gm4788 A T 1: 139,753,011 C256* probably null Het
Heatr5b A G 17: 78,803,434 V995A probably damaging Het
Ifrd2 A G 9: 107,592,091 E346G probably damaging Het
Ism1 AACGGACCCGTTCTTGTGGCTATGCA AA 2: 139,746,042 probably benign Het
Itgb4 T C 11: 115,998,137 V1102A possibly damaging Het
Itgb6 A T 2: 60,605,276 I710N probably damaging Het
Kif1a T C 1: 93,019,983 K1578E probably damaging Het
Kif9 T C 9: 110,517,834 probably null Het
Kitl T C 10: 100,089,233 *57Q probably null Het
Lrat C A 3: 82,903,505 V70F probably damaging Het
Lrrc9 T A 12: 72,487,023 M1022K probably benign Het
Muc16 T C 9: 18,655,599 T1875A unknown Het
Mup4 T A 4: 59,957,890 N171I probably damaging Het
Npas4 G A 19: 4,986,375 T587I probably damaging Het
Oas3 A G 5: 120,771,230 V217A probably benign Het
Olfr786 A G 10: 129,437,688 N292S possibly damaging Het
Osbp C A 19: 11,977,953 A323D possibly damaging Het
Panx2 G A 15: 89,067,618 R96H probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Piezo2 T C 18: 63,121,270 R385G possibly damaging Het
Pkn2 T C 3: 142,811,599 T476A probably damaging Het
Plekha4 T C 7: 45,553,802 probably benign Het
Ppfibp2 T C 7: 107,681,762 S94P probably damaging Het
Pramel7 T A 2: 87,489,663 I429L probably benign Het
Rif1 A G 2: 52,085,053 K325E probably damaging Het
Ror2 T C 13: 53,110,542 Y826C probably damaging Het
Rsph10b G A 5: 143,959,746 G19R probably damaging Het
Slc20a1 A G 2: 129,208,004 N361D probably damaging Het
Slc26a9 A G 1: 131,763,909 D630G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Trank1 T C 9: 111,352,246 probably null Het
Tspan10 T A 11: 120,444,542 C159* probably null Het
Uba6 G A 5: 86,164,765 T23I probably benign Het
Vmn2r74 T C 7: 85,952,451 T660A possibly damaging Het
Vwa5b1 T C 4: 138,578,672 N905S probably benign Het
Zfp831 T C 2: 174,646,421 L963P possibly damaging Het
Zfp990 T A 4: 145,537,789 N452K probably benign Het
Other mutations in Efcab7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Efcab7 APN 4 99831463 missense probably benign 0.12
3-1:Efcab7 UTSW 4 99901769 missense possibly damaging 0.83
R0023:Efcab7 UTSW 4 99901637 splice site probably benign
R0085:Efcab7 UTSW 4 99904680 unclassified probably benign
R0122:Efcab7 UTSW 4 99892363 splice site probably benign
R0326:Efcab7 UTSW 4 99831394 missense possibly damaging 0.86
R0382:Efcab7 UTSW 4 99901769 missense possibly damaging 0.83
R0410:Efcab7 UTSW 4 99878285 critical splice donor site probably null
R0413:Efcab7 UTSW 4 99909746 missense probably damaging 1.00
R0611:Efcab7 UTSW 4 99901689 missense probably damaging 1.00
R0689:Efcab7 UTSW 4 99904784 missense probably damaging 1.00
R1114:Efcab7 UTSW 4 99878250 nonsense probably null
R1459:Efcab7 UTSW 4 99912547 missense probably null 1.00
R1722:Efcab7 UTSW 4 99900618 missense probably benign 0.36
R1932:Efcab7 UTSW 4 99911018 missense probably damaging 1.00
R1954:Efcab7 UTSW 4 99900690 missense probably damaging 1.00
R2305:Efcab7 UTSW 4 99831481 missense possibly damaging 0.95
R2358:Efcab7 UTSW 4 99831586 unclassified probably benign
R2845:Efcab7 UTSW 4 99909638 missense probably damaging 0.99
R3915:Efcab7 UTSW 4 99878173 missense probably damaging 0.98
R4469:Efcab7 UTSW 4 99909704 missense possibly damaging 0.73
R4686:Efcab7 UTSW 4 99878116 missense probably benign 0.29
R4737:Efcab7 UTSW 4 99831568 nonsense probably null
R4970:Efcab7 UTSW 4 99831543 missense probably damaging 1.00
R5120:Efcab7 UTSW 4 99897491 missense probably damaging 1.00
R5264:Efcab7 UTSW 4 99878170 missense probably benign 0.27
R5366:Efcab7 UTSW 4 99904734 missense possibly damaging 0.95
R5901:Efcab7 UTSW 4 99909744 missense probably damaging 0.99
R6438:Efcab7 UTSW 4 99909772 missense probably benign 0.39
R6451:Efcab7 UTSW 4 99831501 nonsense probably null
R6717:Efcab7 UTSW 4 99904734 missense possibly damaging 0.95
R6766:Efcab7 UTSW 4 99877959 frame shift probably null
R6855:Efcab7 UTSW 4 99900580 nonsense probably null
R6865:Efcab7 UTSW 4 99912596 missense probably damaging 1.00
R7868:Efcab7 UTSW 4 99888957 missense probably benign 0.01
R7893:Efcab7 UTSW 4 99888861 missense probably damaging 1.00
R8069:Efcab7 UTSW 4 99829378 missense unknown
R8787:Efcab7 UTSW 4 99900594 missense probably null 0.99
R9214:Efcab7 UTSW 4 99878235 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2018-02-28