Incidental Mutation 'R6255:Vwa5b1'
ID 506047
Institutional Source Beutler Lab
Gene Symbol Vwa5b1
Ensembl Gene ENSMUSG00000028753
Gene Name von Willebrand factor A domain containing 5B1
MMRRC Submission 044372-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6255 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 138565360-138635884 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 138578672 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 905 (N905S)
Ref Sequence ENSEMBL: ENSMUSP00000030533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030533] [ENSMUST00000105812]
AlphaFold A9Z1V5
Predicted Effect probably benign
Transcript: ENSMUST00000030533
AA Change: N905S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030533
Gene: ENSMUSG00000028753
AA Change: N905S

Pfam:VIT_2 2 79 2e-28 PFAM
Pfam:VIT 15 138 1.5e-7 PFAM
VWA 351 513 6.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105812
SMART Domains Protein: ENSMUSP00000101438
Gene: ENSMUSG00000028753

Pfam:VIT_2 16 93 1.9e-30 PFAM
Pfam:VIT 29 103 2.1e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000137206
AA Change: N91S
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,123 V7E possibly damaging Het
Aars2 G A 17: 45,514,609 G333S probably damaging Het
Aen T A 7: 78,905,844 I85N probably damaging Het
Ahnak C A 19: 9,008,025 H2224Q possibly damaging Het
Aldh18a1 C T 19: 40,580,043 R41H possibly damaging Het
Bpifb9b T A 2: 154,309,364 W2R probably damaging Het
Caprin2 A G 6: 148,877,892 I139T probably benign Het
Cdhr3 T A 12: 33,053,475 N381I probably damaging Het
Cecr2 A G 6: 120,758,050 Y721C probably damaging Het
Cherp G T 8: 72,470,881 A125D probably damaging Het
Cped1 G A 6: 22,138,715 probably null Het
Ctdp1 T A 18: 80,459,297 probably null Het
Cyp2c55 T C 19: 39,018,667 I169T probably benign Het
Cyp4a31 T C 4: 115,574,920 L418P possibly damaging Het
Efcab7 T C 4: 99,829,390 probably benign Het
Efcab8 T C 2: 153,810,268 W466R possibly damaging Het
Ehd3 C A 17: 73,805,413 N57K probably benign Het
Ern2 C A 7: 122,173,272 K654N probably damaging Het
Fbxo18 A T 2: 11,748,446 F879L probably benign Het
Gde1 T C 7: 118,691,781 D92G probably null Het
Gm4788 A T 1: 139,753,011 C256* probably null Het
Heatr5b A G 17: 78,803,434 V995A probably damaging Het
Ifrd2 A G 9: 107,592,091 E346G probably damaging Het
Ism1 AACGGACCCGTTCTTGTGGCTATGCA AA 2: 139,746,042 probably benign Het
Itgb4 T C 11: 115,998,137 V1102A possibly damaging Het
Itgb6 A T 2: 60,605,276 I710N probably damaging Het
Kif1a T C 1: 93,019,983 K1578E probably damaging Het
Kif9 T C 9: 110,517,834 probably null Het
Kitl T C 10: 100,089,233 *57Q probably null Het
Lrat C A 3: 82,903,505 V70F probably damaging Het
Lrrc9 T A 12: 72,487,023 M1022K probably benign Het
Muc16 T C 9: 18,655,599 T1875A unknown Het
Mup4 T A 4: 59,957,890 N171I probably damaging Het
Npas4 G A 19: 4,986,375 T587I probably damaging Het
Oas3 A G 5: 120,771,230 V217A probably benign Het
Olfr786 A G 10: 129,437,688 N292S possibly damaging Het
Osbp C A 19: 11,977,953 A323D possibly damaging Het
Panx2 G A 15: 89,067,618 R96H probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Piezo2 T C 18: 63,121,270 R385G possibly damaging Het
Pkn2 T C 3: 142,811,599 T476A probably damaging Het
Plekha4 T C 7: 45,553,802 probably benign Het
Ppfibp2 T C 7: 107,681,762 S94P probably damaging Het
Pramel7 T A 2: 87,489,663 I429L probably benign Het
Rif1 A G 2: 52,085,053 K325E probably damaging Het
Ror2 T C 13: 53,110,542 Y826C probably damaging Het
Rsph10b G A 5: 143,959,746 G19R probably damaging Het
Slc20a1 A G 2: 129,208,004 N361D probably damaging Het
Slc26a9 A G 1: 131,763,909 D630G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Trank1 T C 9: 111,352,246 probably null Het
Tspan10 T A 11: 120,444,542 C159* probably null Het
Uba6 G A 5: 86,164,765 T23I probably benign Het
Vmn2r74 T C 7: 85,952,451 T660A possibly damaging Het
Zfp831 T C 2: 174,646,421 L963P possibly damaging Het
Zfp990 T A 4: 145,537,789 N452K probably benign Het
Other mutations in Vwa5b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01952:Vwa5b1 APN 4 138581217 missense probably benign 0.08
IGL02133:Vwa5b1 APN 4 138586557 critical splice donor site probably null
IGL02379:Vwa5b1 APN 4 138612859 missense probably damaging 1.00
IGL02671:Vwa5b1 APN 4 138569126 nonsense probably null
IGL02864:Vwa5b1 APN 4 138608975 missense probably benign 0.00
IGL03076:Vwa5b1 APN 4 138600188 missense probably damaging 1.00
IGL03115:Vwa5b1 APN 4 138600149 missense possibly damaging 0.93
IGL03119:Vwa5b1 APN 4 138606541 missense probably benign 0.01
PIT4283001:Vwa5b1 UTSW 4 138600263 missense probably damaging 1.00
R0114:Vwa5b1 UTSW 4 138608858 nonsense probably null
R0157:Vwa5b1 UTSW 4 138604879 missense probably benign 0.00
R0528:Vwa5b1 UTSW 4 138594351 missense probably damaging 1.00
R0562:Vwa5b1 UTSW 4 138635711 splice site probably benign
R0718:Vwa5b1 UTSW 4 138608824 missense probably damaging 1.00
R1555:Vwa5b1 UTSW 4 138605477 missense probably benign 0.02
R1573:Vwa5b1 UTSW 4 138604873 missense probably damaging 1.00
R1857:Vwa5b1 UTSW 4 138569102 missense probably damaging 1.00
R1883:Vwa5b1 UTSW 4 138575389 missense probably damaging 0.96
R1906:Vwa5b1 UTSW 4 138600236 missense possibly damaging 0.93
R1913:Vwa5b1 UTSW 4 138592020 nonsense probably null
R2121:Vwa5b1 UTSW 4 138588569 missense probably benign 0.00
R2213:Vwa5b1 UTSW 4 138604812 missense probably benign 0.00
R2355:Vwa5b1 UTSW 4 138591910 critical splice donor site probably null
R2655:Vwa5b1 UTSW 4 138594303 missense probably damaging 1.00
R4134:Vwa5b1 UTSW 4 138594330 missense possibly damaging 0.69
R4135:Vwa5b1 UTSW 4 138594330 missense possibly damaging 0.69
R4635:Vwa5b1 UTSW 4 138610839 missense possibly damaging 0.82
R4773:Vwa5b1 UTSW 4 138581755 missense probably benign 0.01
R4832:Vwa5b1 UTSW 4 138605540 missense probably damaging 1.00
R4906:Vwa5b1 UTSW 4 138610747 missense probably benign 0.03
R4916:Vwa5b1 UTSW 4 138594262 missense possibly damaging 0.81
R4995:Vwa5b1 UTSW 4 138608843 missense probably damaging 1.00
R5573:Vwa5b1 UTSW 4 138608890 missense probably damaging 1.00
R5872:Vwa5b1 UTSW 4 138578651 missense possibly damaging 0.63
R6811:Vwa5b1 UTSW 4 138592103 missense probably benign 0.00
R6901:Vwa5b1 UTSW 4 138586569 missense probably benign
R7144:Vwa5b1 UTSW 4 138605431 critical splice donor site probably null
R7146:Vwa5b1 UTSW 4 138581612 missense probably benign 0.00
R7159:Vwa5b1 UTSW 4 138575422 missense possibly damaging 0.56
R7362:Vwa5b1 UTSW 4 138594312 missense probably damaging 1.00
R7690:Vwa5b1 UTSW 4 138590933 missense probably damaging 0.98
R7908:Vwa5b1 UTSW 4 138569170 nonsense probably null
R7965:Vwa5b1 UTSW 4 138605489 missense probably damaging 1.00
R8865:Vwa5b1 UTSW 4 138581219 missense probably benign 0.02
R8866:Vwa5b1 UTSW 4 138600317 missense probably damaging 1.00
R8872:Vwa5b1 UTSW 4 138578645 missense probably damaging 1.00
R8889:Vwa5b1 UTSW 4 138610730 missense probably benign 0.01
R9045:Vwa5b1 UTSW 4 138588679 missense probably damaging 1.00
R9089:Vwa5b1 UTSW 4 138569431 missense probably benign 0.08
R9273:Vwa5b1 UTSW 4 138588694 missense probably damaging 1.00
R9366:Vwa5b1 UTSW 4 138590918 missense probably damaging 0.97
Z1177:Vwa5b1 UTSW 4 138612838 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2018-02-28