Incidental Mutation 'R6255:Uba6'
ID506049
Institutional Source Beutler Lab
Gene Symbol Uba6
Ensembl Gene ENSMUSG00000035898
Gene Nameubiquitin-like modifier activating enzyme 6
SynonymsUbe1l2, 5730469D23Rik
MMRRC Submission 044372-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6255 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location86109287-86172803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86164765 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 23 (T23I)
Ref Sequence ENSEMBL: ENSMUSP00000109000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039373] [ENSMUST00000113373]
Predicted Effect probably benign
Transcript: ENSMUST00000039373
AA Change: T54I

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000035328
Gene: ENSMUSG00000035898
AA Change: T54I

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
Pfam:ThiF 44 431 8.9e-29 PFAM
Pfam:E1_FCCH 224 293 1.7e-28 PFAM
Pfam:E1_4HB 294 362 9.8e-21 PFAM
internal_repeat_1 443 588 1.25e-6 PROSPERO
Pfam:UBA_e1_thiolCys 631 884 3.7e-80 PFAM
UBA_e1_C 921 1043 1.04e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113373
AA Change: T23I

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000109000
Gene: ENSMUSG00000035898
AA Change: T23I

DomainStartEndE-ValueType
Pfam:ThiF 29 167 1.8e-16 PFAM
Pfam:ThiF 428 573 8.5e-34 PFAM
Pfam:UBA_e1_thiolCys 575 619 2.3e-22 PFAM
Pfam:UBACT 817 885 2.9e-28 PFAM
UBA_e1_C 890 1012 1.04e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147734
Meta Mutation Damage Score 0.0661 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of proteins with ubiquitin (UBB; MIM 191339) or ubiquitin-like proteins controls many signaling networks and requires a ubiquitin-activating enzyme (E1), a ubiquitin conjugating enzyme (E2), and a ubiquitin protein ligase (E3). UBE1L2 is an E1 enzyme that initiates the activation and conjugation of ubiquitin-like proteins (Jin et al., 2007 [PubMed 17597759]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice homozygous for a conditional allele activated in neurons exhibit decreased weight, postnatal and premature lethality and altered social behavior and neuronal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,123 V7E possibly damaging Het
Aars2 G A 17: 45,514,609 G333S probably damaging Het
Aen T A 7: 78,905,844 I85N probably damaging Het
Ahnak C A 19: 9,008,025 H2224Q possibly damaging Het
Aldh18a1 C T 19: 40,580,043 R41H possibly damaging Het
Bpifb9b T A 2: 154,309,364 W2R probably damaging Het
Caprin2 A G 6: 148,877,892 I139T probably benign Het
Cdhr3 T A 12: 33,053,475 N381I probably damaging Het
Cecr2 A G 6: 120,758,050 Y721C probably damaging Het
Cherp G T 8: 72,470,881 A125D probably damaging Het
Cped1 G A 6: 22,138,715 probably null Het
Ctdp1 T A 18: 80,459,297 probably null Het
Cyp2c55 T C 19: 39,018,667 I169T probably benign Het
Cyp4a31 T C 4: 115,574,920 L418P possibly damaging Het
Efcab7 T C 4: 99,829,390 probably benign Het
Efcab8 T C 2: 153,810,268 W466R possibly damaging Het
Ehd3 C A 17: 73,805,413 N57K probably benign Het
Ern2 C A 7: 122,173,272 K654N probably damaging Het
Fbxo18 A T 2: 11,748,446 F879L probably benign Het
Gde1 T C 7: 118,691,781 D92G probably null Het
Gm4788 A T 1: 139,753,011 C256* probably null Het
Heatr5b A G 17: 78,803,434 V995A probably damaging Het
Ifrd2 A G 9: 107,592,091 E346G probably damaging Het
Ism1 AACGGACCCGTTCTTGTGGCTATGCA AA 2: 139,746,042 probably benign Het
Itgb4 T C 11: 115,998,137 V1102A possibly damaging Het
Itgb6 A T 2: 60,605,276 I710N probably damaging Het
Kif1a T C 1: 93,019,983 K1578E probably damaging Het
Kif9 T C 9: 110,517,834 probably null Het
Kitl T C 10: 100,089,233 *57Q probably null Het
Lrat C A 3: 82,903,505 V70F probably damaging Het
Lrrc9 T A 12: 72,487,023 M1022K probably benign Het
Muc16 T C 9: 18,655,599 T1875A unknown Het
Mup4 T A 4: 59,957,890 N171I probably damaging Het
Npas4 G A 19: 4,986,375 T587I probably damaging Het
Oas3 A G 5: 120,771,230 V217A probably benign Het
Olfr786 A G 10: 129,437,688 N292S possibly damaging Het
Osbp C A 19: 11,977,953 A323D possibly damaging Het
Panx2 G A 15: 89,067,618 R96H probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Piezo2 T C 18: 63,121,270 R385G possibly damaging Het
Pkn2 T C 3: 142,811,599 T476A probably damaging Het
Plekha4 T C 7: 45,553,802 probably benign Het
Ppfibp2 T C 7: 107,681,762 S94P probably damaging Het
Pramel7 T A 2: 87,489,663 I429L probably benign Het
Rif1 A G 2: 52,085,053 K325E probably damaging Het
Ror2 T C 13: 53,110,542 Y826C probably damaging Het
Rsph10b G A 5: 143,959,746 G19R probably damaging Het
Slc20a1 A G 2: 129,208,004 N361D probably damaging Het
Slc26a9 A G 1: 131,763,909 D630G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Trank1 T C 9: 111,352,246 probably null Het
Tspan10 T A 11: 120,444,542 C159* probably null Het
Vmn2r74 T C 7: 85,952,451 T660A possibly damaging Het
Vwa5b1 T C 4: 138,578,672 N905S probably benign Het
Zfp831 T C 2: 174,646,421 L963P possibly damaging Het
Zfp990 T A 4: 145,537,789 N452K probably benign Het
Other mutations in Uba6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Uba6 APN 5 86119407 missense possibly damaging 0.51
IGL01294:Uba6 APN 5 86150048 missense possibly damaging 0.67
IGL01625:Uba6 APN 5 86120529 nonsense probably null
IGL01807:Uba6 APN 5 86122411 missense probably damaging 1.00
IGL01919:Uba6 APN 5 86119386 missense probably benign 0.01
IGL02131:Uba6 APN 5 86150077 missense probably benign 0.18
IGL03107:Uba6 APN 5 86127774 splice site probably benign
R0314:Uba6 UTSW 5 86118087 missense probably damaging 0.99
R0350:Uba6 UTSW 5 86144378 missense possibly damaging 0.48
R0511:Uba6 UTSW 5 86112750 missense probably damaging 1.00
R0964:Uba6 UTSW 5 86119401 missense possibly damaging 0.47
R1086:Uba6 UTSW 5 86127719 missense probably benign 0.00
R1440:Uba6 UTSW 5 86140423 missense probably damaging 1.00
R1564:Uba6 UTSW 5 86154407 missense probably benign
R2377:Uba6 UTSW 5 86124370 missense possibly damaging 0.90
R2420:Uba6 UTSW 5 86132616 critical splice donor site probably null
R2421:Uba6 UTSW 5 86132616 critical splice donor site probably null
R2422:Uba6 UTSW 5 86132616 critical splice donor site probably null
R2924:Uba6 UTSW 5 86159271 missense probably damaging 1.00
R3723:Uba6 UTSW 5 86135047 missense probably damaging 1.00
R3724:Uba6 UTSW 5 86135047 missense probably damaging 1.00
R4429:Uba6 UTSW 5 86120547 missense probably damaging 0.99
R4590:Uba6 UTSW 5 86112744 missense probably damaging 1.00
R4831:Uba6 UTSW 5 86131338 missense probably benign
R4908:Uba6 UTSW 5 86140434 splice site silent
R5193:Uba6 UTSW 5 86124422 missense probably benign 0.12
R5505:Uba6 UTSW 5 86120546 missense probably benign 0.09
R5560:Uba6 UTSW 5 86131260 missense probably damaging 1.00
R5586:Uba6 UTSW 5 86135047 missense probably damaging 1.00
R5589:Uba6 UTSW 5 86122429 missense probably damaging 0.99
R5787:Uba6 UTSW 5 86112652 makesense probably null
R6512:Uba6 UTSW 5 86124403 missense probably benign
R6772:Uba6 UTSW 5 86147073 critical splice donor site probably null
R7536:Uba6 UTSW 5 86124332 missense probably benign 0.05
R7571:Uba6 UTSW 5 86147111 missense probably benign 0.02
R7609:Uba6 UTSW 5 86147075 missense probably benign 0.17
R7768:Uba6 UTSW 5 86152920 missense probably benign 0.01
R7866:Uba6 UTSW 5 86172701 missense probably damaging 0.99
R7894:Uba6 UTSW 5 86118065 nonsense probably null
R7922:Uba6 UTSW 5 86122412 synonymous probably null
R7949:Uba6 UTSW 5 86172701 missense probably damaging 0.99
R7977:Uba6 UTSW 5 86118065 nonsense probably null
R8063:Uba6 UTSW 5 86152685 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TGGTGGAAGATCATACCTCTGC -3'
(R):5'- GCTAGCAATTCAGTTGGTTAGCTG -3'

Sequencing Primer
(F):5'- CCAATATTTGGAAGCTAATTTCC -3'
(R):5'- GCTGTAAATGCCGTATAACTTAGC -3'
Posted On2018-02-28