Mutagenetix > Incidental Mutations

Incidental Mutation 'R6255:Uba6'

506049

Institutional Source

Beutler Lab

Gene Symbol

Uba6

Ensembl Gene

ENSMUSG00000035898

Gene Name

ubiquitin-like modifier activating enzyme 6

Synonyms

Ube1l2, 5730469D23Rik

MMRRC Submission

044372-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6255 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86109287-86172803 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 86164765 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 23 (T23I)

Ref Sequence

ENSEMBL: ENSMUSP00000109000 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039373] [ENSMUST00000113373]

AlphaFold

Q8C7R4

Predicted Effect

probably benign
Transcript: ENSMUST00000039373
AA Change: T54I

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000035328
Gene: ENSMUSG00000035898
AA Change: T54I

Domain	Start	End	E-Value	Type
low complexity region	15	26	N/A	INTRINSIC
Pfam:ThiF	44	431	8.9e-29	PFAM
Pfam:E1_FCCH	224	293	1.7e-28	PFAM
Pfam:E1_4HB	294	362	9.8e-21	PFAM
internal_repeat_1	443	588	1.25e-6	PROSPERO
Pfam:UBA_e1_thiolCys	631	884	3.7e-80	PFAM
UBA_e1_C	921	1043	1.04e-49	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113373
AA Change: T23I

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000109000
Gene: ENSMUSG00000035898
AA Change: T23I

Domain	Start	End	E-Value	Type
Pfam:ThiF	29	167	1.8e-16	PFAM
Pfam:ThiF	428	573	8.5e-34	PFAM
Pfam:UBA_e1_thiolCys	575	619	2.3e-22	PFAM
Pfam:UBACT	817	885	2.9e-28	PFAM
UBA_e1_C	890	1012	1.04e-49	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147734

Meta Mutation Damage Score

0.0661

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of proteins with ubiquitin (UBB; MIM 191339) or ubiquitin-like proteins controls many signaling networks and requires a ubiquitin-activating enzyme (E1), a ubiquitin conjugating enzyme (E2), and a ubiquitin protein ligase (E3). UBE1L2 is an E1 enzyme that initiates the activation and conjugation of ubiquitin-like proteins (Jin et al., 2007 [PubMed 17597759]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice homozygous for a conditional allele activated in neurons exhibit decreased weight, postnatal and premature lethality and altered social behavior and neuronal development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	T	A	13: 119,466,123	V7E	possibly damaging	Het
Aars2	G	A	17: 45,514,609	G333S	probably damaging	Het
Aen	T	A	7: 78,905,844	I85N	probably damaging	Het
Ahnak	C	A	19: 9,008,025	H2224Q	possibly damaging	Het
Aldh18a1	C	T	19: 40,580,043	R41H	possibly damaging	Het
Bpifb9b	T	A	2: 154,309,364	W2R	probably damaging	Het
Caprin2	A	G	6: 148,877,892	I139T	probably benign	Het
Cdhr3	T	A	12: 33,053,475	N381I	probably damaging	Het
Cecr2	A	G	6: 120,758,050	Y721C	probably damaging	Het
Cherp	G	T	8: 72,470,881	A125D	probably damaging	Het
Cped1	G	A	6: 22,138,715		probably null	Het
Ctdp1	T	A	18: 80,459,297		probably null	Het
Cyp2c55	T	C	19: 39,018,667	I169T	probably benign	Het
Cyp4a31	T	C	4: 115,574,920	L418P	possibly damaging	Het
Efcab7	T	C	4: 99,829,390		probably benign	Het
Efcab8	T	C	2: 153,810,268	W466R	possibly damaging	Het
Ehd3	C	A	17: 73,805,413	N57K	probably benign	Het
Ern2	C	A	7: 122,173,272	K654N	probably damaging	Het
Fbxo18	A	T	2: 11,748,446	F879L	probably benign	Het
Gde1	T	C	7: 118,691,781	D92G	probably null	Het
Gm4788	A	T	1: 139,753,011	C256*	probably null	Het
Heatr5b	A	G	17: 78,803,434	V995A	probably damaging	Het
Ifrd2	A	G	9: 107,592,091	E346G	probably damaging	Het
Ism1	AACGGACCCGTTCTTGTGGCTATGCA	AA	2: 139,746,042		probably benign	Het
Itgb4	T	C	11: 115,998,137	V1102A	possibly damaging	Het
Itgb6	A	T	2: 60,605,276	I710N	probably damaging	Het
Kif1a	T	C	1: 93,019,983	K1578E	probably damaging	Het
Kif9	T	C	9: 110,517,834		probably null	Het
Kitl	T	C	10: 100,089,233	*57Q	probably null	Het
Lrat	C	A	3: 82,903,505	V70F	probably damaging	Het
Lrrc9	T	A	12: 72,487,023	M1022K	probably benign	Het
Muc16	T	C	9: 18,655,599	T1875A	unknown	Het
Mup4	T	A	4: 59,957,890	N171I	probably damaging	Het
Npas4	G	A	19: 4,986,375	T587I	probably damaging	Het
Oas3	A	G	5: 120,771,230	V217A	probably benign	Het
Olfr786	A	G	10: 129,437,688	N292S	possibly damaging	Het
Osbp	C	A	19: 11,977,953	A323D	possibly damaging	Het
Panx2	G	A	15: 89,067,618	R96H	probably damaging	Het
Pcdhb18	G	A	18: 37,490,484	R289Q	probably benign	Het
Piezo2	T	C	18: 63,121,270	R385G	possibly damaging	Het
Pkn2	T	C	3: 142,811,599	T476A	probably damaging	Het
Plekha4	T	C	7: 45,553,802		probably benign	Het
Ppfibp2	T	C	7: 107,681,762	S94P	probably damaging	Het
Pramel7	T	A	2: 87,489,663	I429L	probably benign	Het
Rif1	A	G	2: 52,085,053	K325E	probably damaging	Het
Ror2	T	C	13: 53,110,542	Y826C	probably damaging	Het
Rsph10b	G	A	5: 143,959,746	G19R	probably damaging	Het
Slc20a1	A	G	2: 129,208,004	N361D	probably damaging	Het
Slc26a9	A	G	1: 131,763,909	D630G	probably benign	Het
Smtnl2	G	A	11: 72,401,399	A274V	probably damaging	Het
Trank1	T	C	9: 111,352,246		probably null	Het
Tspan10	T	A	11: 120,444,542	C159*	probably null	Het
Vmn2r74	T	C	7: 85,952,451	T660A	possibly damaging	Het
Vwa5b1	T	C	4: 138,578,672	N905S	probably benign	Het
Zfp831	T	C	2: 174,646,421	L963P	possibly damaging	Het
Zfp990	T	A	4: 145,537,789	N452K	probably benign	Het

Other mutations in Uba6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00555:Uba6	APN	5	86119407	missense	possibly damaging	0.51
IGL01294:Uba6	APN	5	86150048	missense	possibly damaging	0.67
IGL01625:Uba6	APN	5	86120529	nonsense	probably null
IGL01807:Uba6	APN	5	86122411	missense	probably damaging	1.00
IGL01919:Uba6	APN	5	86119386	missense	probably benign	0.01
IGL02131:Uba6	APN	5	86150077	missense	probably benign	0.18
IGL03107:Uba6	APN	5	86127774	splice site	probably benign
R0314:Uba6	UTSW	5	86118087	missense	probably damaging	0.99
R0350:Uba6	UTSW	5	86144378	missense	possibly damaging	0.48
R0511:Uba6	UTSW	5	86112750	missense	probably damaging	1.00
R0964:Uba6	UTSW	5	86119401	missense	possibly damaging	0.47
R1086:Uba6	UTSW	5	86127719	missense	probably benign	0.00
R1440:Uba6	UTSW	5	86140423	missense	probably damaging	1.00
R1564:Uba6	UTSW	5	86154407	missense	probably benign
R2377:Uba6	UTSW	5	86124370	missense	possibly damaging	0.90
R2420:Uba6	UTSW	5	86132616	critical splice donor site	probably null
R2421:Uba6	UTSW	5	86132616	critical splice donor site	probably null
R2422:Uba6	UTSW	5	86132616	critical splice donor site	probably null
R2924:Uba6	UTSW	5	86159271	missense	probably damaging	1.00
R3723:Uba6	UTSW	5	86135047	missense	probably damaging	1.00
R3724:Uba6	UTSW	5	86135047	missense	probably damaging	1.00
R4429:Uba6	UTSW	5	86120547	missense	probably damaging	0.99
R4590:Uba6	UTSW	5	86112744	missense	probably damaging	1.00
R4831:Uba6	UTSW	5	86131338	missense	probably benign
R4908:Uba6	UTSW	5	86140434	splice site	silent
R5193:Uba6	UTSW	5	86124422	missense	probably benign	0.12
R5505:Uba6	UTSW	5	86120546	missense	probably benign	0.09
R5560:Uba6	UTSW	5	86131260	missense	probably damaging	1.00
R5586:Uba6	UTSW	5	86135047	missense	probably damaging	1.00
R5589:Uba6	UTSW	5	86122429	missense	probably damaging	0.99
R5787:Uba6	UTSW	5	86112652	makesense	probably null
R6512:Uba6	UTSW	5	86124403	missense	probably benign
R6772:Uba6	UTSW	5	86147073	critical splice donor site	probably benign
R7536:Uba6	UTSW	5	86124332	missense	probably benign	0.05
R7571:Uba6	UTSW	5	86147111	missense	probably benign	0.02
R7609:Uba6	UTSW	5	86147075	missense	probably benign	0.17
R7768:Uba6	UTSW	5	86152920	missense	probably benign	0.01
R7839:Uba6	UTSW	5	86122412	splice site	probably null
R7866:Uba6	UTSW	5	86172701	missense	probably damaging	0.99
R7894:Uba6	UTSW	5	86118065	nonsense	probably null
R8063:Uba6	UTSW	5	86152685	missense	probably benign	0.29
R8276:Uba6	UTSW	5	86142650	intron	probably benign
R8382:Uba6	UTSW	5	86131337	missense	probably benign	0.01
R8516:Uba6	UTSW	5	86127748	missense	possibly damaging	0.78
R8673:Uba6	UTSW	5	86136319	missense	probably damaging	1.00
R8778:Uba6	UTSW	5	86112697	missense	possibly damaging	0.54
R8817:Uba6	UTSW	5	86148913	missense	probably null	0.10
R8822:Uba6	UTSW	5	86147073	critical splice donor site	probably benign
R8852:Uba6	UTSW	5	86141595	missense	possibly damaging	0.47
R8887:Uba6	UTSW	5	86159202	critical splice donor site	probably null
R9108:Uba6	UTSW	5	86135075	missense	possibly damaging	0.69
R9245:Uba6	UTSW	5	86170559	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGTGGAAGATCATACCTCTGC -3'
(R):5'- GCTAGCAATTCAGTTGGTTAGCTG -3'

Sequencing Primer
(F):5'- CCAATATTTGGAAGCTAATTTCC -3'
(R):5'- GCTGTAAATGCCGTATAACTTAGC -3'

Posted On

2018-02-28