Mutagenetix > Incidental Mutations

Incidental Mutation 'R6255:Cped1'

506052

Institutional Source

Beutler Lab

Gene Symbol

Cped1

Ensembl Gene

ENSMUSG00000062980

Gene Name

cadherin-like and PC-esterase domain containing 1

Synonyms

A430107O13Rik

MMRRC Submission

044372-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.067) question?

Stock #

R6255 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21985916-22256404 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to A at 22138715 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115383]

AlphaFold

B2RX70

Predicted Effect

probably null
Transcript: ENSMUST00000115383

SMART Domains

Protein: ENSMUSP00000111041
Gene: ENSMUSG00000062980

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	110	122	N/A	INTRINSIC
low complexity region	133	147	N/A	INTRINSIC
Pfam:Cadherin-like	574	663	1e-9	PFAM
Pfam:PC-Esterase	753	1018	2e-26	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000137437

SMART Domains

Protein: ENSMUSP00000119808
Gene: ENSMUSG00000062980

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	110	122	N/A	INTRINSIC
low complexity region	133	147	N/A	INTRINSIC
Pfam:Cadherin-like	570	663	6.2e-12	PFAM
Pfam:PC-Esterase	753	963	1.6e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154734

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (58/58)

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	T	A	13: 119,466,123	V7E	possibly damaging	Het
Aars2	G	A	17: 45,514,609	G333S	probably damaging	Het
Aen	T	A	7: 78,905,844	I85N	probably damaging	Het
Ahnak	C	A	19: 9,008,025	H2224Q	possibly damaging	Het
Aldh18a1	C	T	19: 40,580,043	R41H	possibly damaging	Het
Bpifb9b	T	A	2: 154,309,364	W2R	probably damaging	Het
Caprin2	A	G	6: 148,877,892	I139T	probably benign	Het
Cdhr3	T	A	12: 33,053,475	N381I	probably damaging	Het
Cecr2	A	G	6: 120,758,050	Y721C	probably damaging	Het
Cherp	G	T	8: 72,470,881	A125D	probably damaging	Het
Ctdp1	T	A	18: 80,459,297		probably null	Het
Cyp2c55	T	C	19: 39,018,667	I169T	probably benign	Het
Cyp4a31	T	C	4: 115,574,920	L418P	possibly damaging	Het
Efcab7	T	C	4: 99,829,390		probably benign	Het
Efcab8	T	C	2: 153,810,268	W466R	possibly damaging	Het
Ehd3	C	A	17: 73,805,413	N57K	probably benign	Het
Ern2	C	A	7: 122,173,272	K654N	probably damaging	Het
Fbxo18	A	T	2: 11,748,446	F879L	probably benign	Het
Gde1	T	C	7: 118,691,781	D92G	probably null	Het
Gm4788	A	T	1: 139,753,011	C256*	probably null	Het
Heatr5b	A	G	17: 78,803,434	V995A	probably damaging	Het
Ifrd2	A	G	9: 107,592,091	E346G	probably damaging	Het
Ism1	AACGGACCCGTTCTTGTGGCTATGCA	AA	2: 139,746,042		probably benign	Het
Itgb4	T	C	11: 115,998,137	V1102A	possibly damaging	Het
Itgb6	A	T	2: 60,605,276	I710N	probably damaging	Het
Kif1a	T	C	1: 93,019,983	K1578E	probably damaging	Het
Kif9	T	C	9: 110,517,834		probably null	Het
Kitl	T	C	10: 100,089,233	*57Q	probably null	Het
Lrat	C	A	3: 82,903,505	V70F	probably damaging	Het
Lrrc9	T	A	12: 72,487,023	M1022K	probably benign	Het
Muc16	T	C	9: 18,655,599	T1875A	unknown	Het
Mup4	T	A	4: 59,957,890	N171I	probably damaging	Het
Npas4	G	A	19: 4,986,375	T587I	probably damaging	Het
Oas3	A	G	5: 120,771,230	V217A	probably benign	Het
Olfr786	A	G	10: 129,437,688	N292S	possibly damaging	Het
Osbp	C	A	19: 11,977,953	A323D	possibly damaging	Het
Panx2	G	A	15: 89,067,618	R96H	probably damaging	Het
Pcdhb18	G	A	18: 37,490,484	R289Q	probably benign	Het
Piezo2	T	C	18: 63,121,270	R385G	possibly damaging	Het
Pkn2	T	C	3: 142,811,599	T476A	probably damaging	Het
Plekha4	T	C	7: 45,553,802		probably benign	Het
Ppfibp2	T	C	7: 107,681,762	S94P	probably damaging	Het
Pramel7	T	A	2: 87,489,663	I429L	probably benign	Het
Rif1	A	G	2: 52,085,053	K325E	probably damaging	Het
Ror2	T	C	13: 53,110,542	Y826C	probably damaging	Het
Rsph10b	G	A	5: 143,959,746	G19R	probably damaging	Het
Slc20a1	A	G	2: 129,208,004	N361D	probably damaging	Het
Slc26a9	A	G	1: 131,763,909	D630G	probably benign	Het
Smtnl2	G	A	11: 72,401,399	A274V	probably damaging	Het
Trank1	T	C	9: 111,352,246		probably null	Het
Tspan10	T	A	11: 120,444,542	C159*	probably null	Het
Uba6	G	A	5: 86,164,765	T23I	probably benign	Het
Vmn2r74	T	C	7: 85,952,451	T660A	possibly damaging	Het
Vwa5b1	T	C	4: 138,578,672	N905S	probably benign	Het
Zfp831	T	C	2: 174,646,421	L963P	possibly damaging	Het
Zfp990	T	A	4: 145,537,789	N452K	probably benign	Het

Other mutations in Cped1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cped1	APN	6	22215523	missense	probably damaging	1.00
IGL00909:Cped1	APN	6	22122427	splice site	probably benign
IGL01434:Cped1	APN	6	22017005	missense	probably damaging	0.99
IGL01572:Cped1	APN	6	22051301	missense	probably benign	0.00
IGL02063:Cped1	APN	6	22138702	missense	probably damaging	0.98
IGL02216:Cped1	APN	6	22059945	missense	probably damaging	1.00
IGL02257:Cped1	APN	6	22145607	missense	possibly damaging	0.86
IGL02541:Cped1	APN	6	22120989	missense	probably benign	0.00
IGL03008:Cped1	APN	6	22233602	missense	probably benign	0.01
IGL03237:Cped1	APN	6	22233596	missense	probably damaging	1.00
PIT4382001:Cped1	UTSW	6	22222450	nonsense	probably null
PIT4812001:Cped1	UTSW	6	22122294	missense	probably benign	0.02
R0048:Cped1	UTSW	6	22119602	missense	probably benign	0.08
R0128:Cped1	UTSW	6	22121039	missense	probably benign	0.00
R0130:Cped1	UTSW	6	22121039	missense	probably benign	0.00
R0267:Cped1	UTSW	6	22119476	missense	probably damaging	0.99
R0374:Cped1	UTSW	6	22222546	splice site	probably benign
R0482:Cped1	UTSW	6	22016958	missense	probably benign	0.32
R0734:Cped1	UTSW	6	22085041	missense	probably damaging	1.00
R1033:Cped1	UTSW	6	22016951	missense	probably damaging	0.99
R1118:Cped1	UTSW	6	22237699	missense	probably benign	0.19
R1181:Cped1	UTSW	6	22215562	missense	probably damaging	0.99
R1300:Cped1	UTSW	6	22119553	missense	probably benign	0.00
R1485:Cped1	UTSW	6	22132388	critical splice donor site	probably null
R1507:Cped1	UTSW	6	22122261	missense	probably damaging	1.00
R1830:Cped1	UTSW	6	22237728	missense	probably damaging	1.00
R1879:Cped1	UTSW	6	22085015	splice site	probably null
R1902:Cped1	UTSW	6	22120981	splice site	probably null
R1991:Cped1	UTSW	6	22233927	missense	probably damaging	1.00
R2020:Cped1	UTSW	6	22143964	missense	probably benign	0.38
R2883:Cped1	UTSW	6	22143979	missense	probably damaging	1.00
R3011:Cped1	UTSW	6	22088696	missense	probably damaging	1.00
R4466:Cped1	UTSW	6	22123652	missense	probably benign	0.29
R4668:Cped1	UTSW	6	22237653	missense	probably benign	0.06
R4808:Cped1	UTSW	6	22088757	missense	probably damaging	1.00
R5402:Cped1	UTSW	6	22143952	missense	probably benign	0.05
R5417:Cped1	UTSW	6	22233580	missense	probably null	0.01
R5741:Cped1	UTSW	6	22123621	missense	probably benign	0.02
R5821:Cped1	UTSW	6	22138682	missense	probably benign	0.00
R5977:Cped1	UTSW	6	22254608	missense	probably damaging	1.00
R6304:Cped1	UTSW	6	22016923	missense	probably benign	0.14
R6416:Cped1	UTSW	6	22123649	missense	probably damaging	1.00
R6444:Cped1	UTSW	6	21986931	missense	probably benign	0.00
R6617:Cped1	UTSW	6	22215547	nonsense	probably null
R6650:Cped1	UTSW	6	22233976	missense	probably damaging	1.00
R7048:Cped1	UTSW	6	22119470	missense	probably benign	0.36
R7083:Cped1	UTSW	6	22123580	missense	probably benign	0.01
R7234:Cped1	UTSW	6	22254626	missense	probably damaging	0.99
R7387:Cped1	UTSW	6	22059934	missense	probably benign	0.01
R7493:Cped1	UTSW	6	22215513	missense	probably damaging	1.00
R7720:Cped1	UTSW	6	22222431	missense	probably damaging	1.00
R7747:Cped1	UTSW	6	22143974	missense	probably damaging	1.00
R7966:Cped1	UTSW	6	22059954	critical splice donor site	probably null
R8113:Cped1	UTSW	6	22233481	missense	possibly damaging	0.89
R8186:Cped1	UTSW	6	22123588	missense	probably benign	0.01
R8215:Cped1	UTSW	6	22132278	missense	probably damaging	1.00
R8265:Cped1	UTSW	6	22222427	missense	probably benign	0.04
R8280:Cped1	UTSW	6	21986821	missense	unknown
R8286:Cped1	UTSW	6	22254602	missense	probably benign	0.03
R8393:Cped1	UTSW	6	22222466	missense	possibly damaging	0.80
R8503:Cped1	UTSW	6	22145565	missense	probably benign	0.02
R8725:Cped1	UTSW	6	22059942	missense	possibly damaging	0.71
R8727:Cped1	UTSW	6	22059942	missense	possibly damaging	0.71
R8852:Cped1	UTSW	6	22215621	missense	probably damaging	1.00
R8881:Cped1	UTSW	6	22119579	missense	possibly damaging	0.58
R8888:Cped1	UTSW	6	22016963	missense	possibly damaging	0.51
R8983:Cped1	UTSW	6	22138687	missense	probably benign	0.00
R9135:Cped1	UTSW	6	21987013	missense	probably damaging	0.98
X0022:Cped1	UTSW	6	21987046	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- AGCTTTACTGAGAAATGCTTGTGG -3'
(R):5'- AGCCTTAAGATTCCTTGAACCCC -3'

Sequencing Primer
(F):5'- CAGACTAGCTCATTTGTGAACTCCAG -3'
(R):5'- GATTCCTTGAACCCCTAAAAATGAG -3'

Posted On

2018-02-28