Incidental Mutation 'R6255:Vmn2r74'
Institutional Source Beutler Lab
Gene Symbol Vmn2r74
Ensembl Gene ENSMUSG00000090774
Gene Namevomeronasal 2, receptor 74
MMRRC Submission 044372-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R6255 (G1)
Quality Score225.009
Status Validated
Chromosomal Location85951867-85961482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85952451 bp
Amino Acid Change Threonine to Alanine at position 660 (T660A)
Ref Sequence ENSEMBL: ENSMUSP00000126917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166355]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166355
AA Change: T660A

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126917
Gene: ENSMUSG00000090774
AA Change: T660A

signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 467 7.3e-28 PFAM
Pfam:NCD3G 510 562 4.7e-20 PFAM
Pfam:7tm_3 592 830 1.3e-52 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,123 V7E possibly damaging Het
Aars2 G A 17: 45,514,609 G333S probably damaging Het
Aen T A 7: 78,905,844 I85N probably damaging Het
Ahnak C A 19: 9,008,025 H2224Q possibly damaging Het
Aldh18a1 C T 19: 40,580,043 R41H possibly damaging Het
Bpifb9b T A 2: 154,309,364 W2R probably damaging Het
Caprin2 A G 6: 148,877,892 I139T probably benign Het
Cdhr3 T A 12: 33,053,475 N381I probably damaging Het
Cecr2 A G 6: 120,758,050 Y721C probably damaging Het
Cherp G T 8: 72,470,881 A125D probably damaging Het
Cped1 G A 6: 22,138,715 probably null Het
Ctdp1 T A 18: 80,459,297 probably null Het
Cyp2c55 T C 19: 39,018,667 I169T probably benign Het
Cyp4a31 T C 4: 115,574,920 L418P possibly damaging Het
Efcab7 T C 4: 99,829,390 probably benign Het
Efcab8 T C 2: 153,810,268 W466R possibly damaging Het
Ehd3 C A 17: 73,805,413 N57K probably benign Het
Ern2 C A 7: 122,173,272 K654N probably damaging Het
Fbxo18 A T 2: 11,748,446 F879L probably benign Het
Gde1 T C 7: 118,691,781 D92G probably null Het
Gm4788 A T 1: 139,753,011 C256* probably null Het
Heatr5b A G 17: 78,803,434 V995A probably damaging Het
Ifrd2 A G 9: 107,592,091 E346G probably damaging Het
Ism1 AACGGACCCGTTCTTGTGGCTATGCA AA 2: 139,746,042 probably benign Het
Itgb4 T C 11: 115,998,137 V1102A possibly damaging Het
Itgb6 A T 2: 60,605,276 I710N probably damaging Het
Kif1a T C 1: 93,019,983 K1578E probably damaging Het
Kif9 T C 9: 110,517,834 probably null Het
Kitl T C 10: 100,089,233 *57Q probably null Het
Lrat C A 3: 82,903,505 V70F probably damaging Het
Lrrc9 T A 12: 72,487,023 M1022K probably benign Het
Muc16 T C 9: 18,655,599 T1875A unknown Het
Mup4 T A 4: 59,957,890 N171I probably damaging Het
Npas4 G A 19: 4,986,375 T587I probably damaging Het
Oas3 A G 5: 120,771,230 V217A probably benign Het
Olfr786 A G 10: 129,437,688 N292S possibly damaging Het
Osbp C A 19: 11,977,953 A323D possibly damaging Het
Panx2 G A 15: 89,067,618 R96H probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Piezo2 T C 18: 63,121,270 R385G possibly damaging Het
Pkn2 T C 3: 142,811,599 T476A probably damaging Het
Plekha4 T C 7: 45,553,802 probably benign Het
Ppfibp2 T C 7: 107,681,762 S94P probably damaging Het
Pramel7 T A 2: 87,489,663 I429L probably benign Het
Rif1 A G 2: 52,085,053 K325E probably damaging Het
Ror2 T C 13: 53,110,542 Y826C probably damaging Het
Rsph10b G A 5: 143,959,746 G19R probably damaging Het
Slc20a1 A G 2: 129,208,004 N361D probably damaging Het
Slc26a9 A G 1: 131,763,909 D630G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Trank1 T C 9: 111,352,246 probably null Het
Tspan10 T A 11: 120,444,542 C159* probably null Het
Uba6 G A 5: 86,164,765 T23I probably benign Het
Vwa5b1 T C 4: 138,578,672 N905S probably benign Het
Zfp831 T C 2: 174,646,421 L963P possibly damaging Het
Zfp990 T A 4: 145,537,789 N452K probably benign Het
Other mutations in Vmn2r74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Vmn2r74 APN 7 85957130 missense probably benign 0.03
IGL00904:Vmn2r74 APN 7 85957580 missense probably benign 0.05
IGL01285:Vmn2r74 APN 7 85957484 missense possibly damaging 0.54
IGL01300:Vmn2r74 APN 7 85957206 missense probably benign 0.00
IGL01410:Vmn2r74 APN 7 85961292 missense possibly damaging 0.83
IGL01827:Vmn2r74 APN 7 85957592 missense probably benign 0.00
IGL02094:Vmn2r74 APN 7 85961461 missense probably benign 0.01
IGL02252:Vmn2r74 APN 7 85957323 missense probably benign 0.41
IGL02349:Vmn2r74 APN 7 85952516 missense probably damaging 0.99
IGL02438:Vmn2r74 APN 7 85952616 missense probably damaging 0.98
IGL02554:Vmn2r74 APN 7 85957373 missense probably benign 0.00
IGL03036:Vmn2r74 APN 7 85952692 nonsense probably null
IGL03370:Vmn2r74 APN 7 85958057 missense probably benign
R0115:Vmn2r74 UTSW 7 85957356 missense probably benign 0.00
R0333:Vmn2r74 UTSW 7 85952283 missense probably benign 0.06
R0415:Vmn2r74 UTSW 7 85961410 missense probably damaging 1.00
R0571:Vmn2r74 UTSW 7 85952421 missense probably damaging 1.00
R0626:Vmn2r74 UTSW 7 85961309 nonsense probably null
R0659:Vmn2r74 UTSW 7 85955914 splice site probably benign
R1202:Vmn2r74 UTSW 7 85961337 missense possibly damaging 0.83
R1473:Vmn2r74 UTSW 7 85961410 missense probably damaging 1.00
R1908:Vmn2r74 UTSW 7 85952442 missense probably benign
R2079:Vmn2r74 UTSW 7 85957175 missense probably benign 0.00
R2368:Vmn2r74 UTSW 7 85961314 missense probably benign 0.39
R3782:Vmn2r74 UTSW 7 85956114 missense probably benign 0.01
R3824:Vmn2r74 UTSW 7 85958258 missense probably damaging 1.00
R3977:Vmn2r74 UTSW 7 85958137 missense probably benign 0.01
R4182:Vmn2r74 UTSW 7 85957187 missense possibly damaging 0.87
R4289:Vmn2r74 UTSW 7 85957354 missense probably benign
R4294:Vmn2r74 UTSW 7 85957416 missense probably benign 0.14
R4645:Vmn2r74 UTSW 7 85957109 missense probably benign
R4646:Vmn2r74 UTSW 7 85957574 missense probably benign 0.42
R4655:Vmn2r74 UTSW 7 85961347 missense probably benign
R4901:Vmn2r74 UTSW 7 85955991 nonsense probably null
R5532:Vmn2r74 UTSW 7 85951989 missense probably benign 0.32
R5642:Vmn2r74 UTSW 7 85957380 missense probably benign 0.00
R5913:Vmn2r74 UTSW 7 85951890 missense probably damaging 0.98
R6035:Vmn2r74 UTSW 7 85951890 missense probably damaging 0.98
R6035:Vmn2r74 UTSW 7 85951890 missense probably damaging 0.98
R6039:Vmn2r74 UTSW 7 85958318 critical splice acceptor site probably null
R6039:Vmn2r74 UTSW 7 85958318 critical splice acceptor site probably null
R6170:Vmn2r74 UTSW 7 85957140 missense probably benign 0.03
R6232:Vmn2r74 UTSW 7 85958290 missense possibly damaging 0.82
R6238:Vmn2r74 UTSW 7 85952072 missense probably damaging 1.00
R6468:Vmn2r74 UTSW 7 85961391 missense probably benign 0.34
R6732:Vmn2r74 UTSW 7 85957550 missense probably damaging 1.00
R6816:Vmn2r74 UTSW 7 85961413 nonsense probably null
R6836:Vmn2r74 UTSW 7 85957422 missense probably benign 0.00
R6995:Vmn2r74 UTSW 7 85952735 missense probably benign 0.01
R6995:Vmn2r74 UTSW 7 85957652 critical splice acceptor site probably null
R7186:Vmn2r74 UTSW 7 85951942 nonsense probably null
R7246:Vmn2r74 UTSW 7 85955965 missense probably benign
R7374:Vmn2r74 UTSW 7 85957422 missense probably benign 0.02
R7505:Vmn2r74 UTSW 7 85957071 nonsense probably null
R7525:Vmn2r74 UTSW 7 85961302 missense probably benign
R7569:Vmn2r74 UTSW 7 85952336 missense probably damaging 0.99
R7644:Vmn2r74 UTSW 7 85957538 missense probably benign 0.11
R7956:Vmn2r74 UTSW 7 85955958 missense probably benign 0.09
R8119:Vmn2r74 UTSW 7 85961482 start codon destroyed probably null 0.08
R8131:Vmn2r74 UTSW 7 85952735 missense probably benign 0.01
R8147:Vmn2r74 UTSW 7 85956019 nonsense probably null
R8181:Vmn2r74 UTSW 7 85956116 missense probably damaging 1.00
R8184:Vmn2r74 UTSW 7 85952246 missense probably benign 0.00
R8375:Vmn2r74 UTSW 7 85952706 missense possibly damaging 0.64
Z1176:Vmn2r74 UTSW 7 85955627 missense probably damaging 1.00
Z31818:Vmn2r74 UTSW 7 85955521 splice site probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2018-02-28