Mutagenetix > Incidental Mutation

Incidental Mutation 'R6255:Vmn2r74'

506057

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r74

Ensembl Gene

ENSMUSG00000090774

Gene Name

vomeronasal 2, receptor 74

Synonyms

EG546980

MMRRC Submission

044372-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R6255 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85951867-85961482 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85952451 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 660 (T660A)

Ref Sequence

ENSEMBL: ENSMUSP00000126917 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166355]

AlphaFold

E9PW21

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166355
AA Change: T660A

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000126917
Gene: ENSMUSG00000090774
AA Change: T660A

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	467	7.3e-28	PFAM
Pfam:NCD3G	510	562	4.7e-20	PFAM
Pfam:7tm_3	592	830	1.3e-52	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (58/58)

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	T	A	13: 119,466,123	V7E	possibly damaging	Het
Aars2	G	A	17: 45,514,609	G333S	probably damaging	Het
Aen	T	A	7: 78,905,844	I85N	probably damaging	Het
Ahnak	C	A	19: 9,008,025	H2224Q	possibly damaging	Het
Aldh18a1	C	T	19: 40,580,043	R41H	possibly damaging	Het
Bpifb9b	T	A	2: 154,309,364	W2R	probably damaging	Het
Caprin2	A	G	6: 148,877,892	I139T	probably benign	Het
Cdhr3	T	A	12: 33,053,475	N381I	probably damaging	Het
Cecr2	A	G	6: 120,758,050	Y721C	probably damaging	Het
Cherp	G	T	8: 72,470,881	A125D	probably damaging	Het
Cped1	G	A	6: 22,138,715		probably null	Het
Ctdp1	T	A	18: 80,459,297		probably null	Het
Cyp2c55	T	C	19: 39,018,667	I169T	probably benign	Het
Cyp4a31	T	C	4: 115,574,920	L418P	possibly damaging	Het
Efcab7	T	C	4: 99,829,390		probably benign	Het
Efcab8	T	C	2: 153,810,268	W466R	possibly damaging	Het
Ehd3	C	A	17: 73,805,413	N57K	probably benign	Het
Ern2	C	A	7: 122,173,272	K654N	probably damaging	Het
Fbxo18	A	T	2: 11,748,446	F879L	probably benign	Het
Gde1	T	C	7: 118,691,781	D92G	probably null	Het
Gm4788	A	T	1: 139,753,011	C256*	probably null	Het
Heatr5b	A	G	17: 78,803,434	V995A	probably damaging	Het
Ifrd2	A	G	9: 107,592,091	E346G	probably damaging	Het
Ism1	AACGGACCCGTTCTTGTGGCTATGCA	AA	2: 139,746,042		probably benign	Het
Itgb4	T	C	11: 115,998,137	V1102A	possibly damaging	Het
Itgb6	A	T	2: 60,605,276	I710N	probably damaging	Het
Kif1a	T	C	1: 93,019,983	K1578E	probably damaging	Het
Kif9	T	C	9: 110,517,834		probably null	Het
Kitl	T	C	10: 100,089,233	*57Q	probably null	Het
Lrat	C	A	3: 82,903,505	V70F	probably damaging	Het
Lrrc9	T	A	12: 72,487,023	M1022K	probably benign	Het
Muc16	T	C	9: 18,655,599	T1875A	unknown	Het
Mup4	T	A	4: 59,957,890	N171I	probably damaging	Het
Npas4	G	A	19: 4,986,375	T587I	probably damaging	Het
Oas3	A	G	5: 120,771,230	V217A	probably benign	Het
Olfr786	A	G	10: 129,437,688	N292S	possibly damaging	Het
Osbp	C	A	19: 11,977,953	A323D	possibly damaging	Het
Panx2	G	A	15: 89,067,618	R96H	probably damaging	Het
Pcdhb18	G	A	18: 37,490,484	R289Q	probably benign	Het
Piezo2	T	C	18: 63,121,270	R385G	possibly damaging	Het
Pkn2	T	C	3: 142,811,599	T476A	probably damaging	Het
Plekha4	T	C	7: 45,553,802		probably benign	Het
Ppfibp2	T	C	7: 107,681,762	S94P	probably damaging	Het
Pramel7	T	A	2: 87,489,663	I429L	probably benign	Het
Rif1	A	G	2: 52,085,053	K325E	probably damaging	Het
Ror2	T	C	13: 53,110,542	Y826C	probably damaging	Het
Rsph10b	G	A	5: 143,959,746	G19R	probably damaging	Het
Slc20a1	A	G	2: 129,208,004	N361D	probably damaging	Het
Slc26a9	A	G	1: 131,763,909	D630G	probably benign	Het
Smtnl2	G	A	11: 72,401,399	A274V	probably damaging	Het
Trank1	T	C	9: 111,352,246		probably null	Het
Tspan10	T	A	11: 120,444,542	C159*	probably null	Het
Uba6	G	A	5: 86,164,765	T23I	probably benign	Het
Vwa5b1	T	C	4: 138,578,672	N905S	probably benign	Het
Zfp831	T	C	2: 174,646,421	L963P	possibly damaging	Het
Zfp990	T	A	4: 145,537,789	N452K	probably benign	Het

Other mutations in Vmn2r74

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00899:Vmn2r74	APN	7	85957130	missense	probably benign	0.03
IGL00904:Vmn2r74	APN	7	85957580	missense	probably benign	0.05
IGL01285:Vmn2r74	APN	7	85957484	missense	possibly damaging	0.54
IGL01300:Vmn2r74	APN	7	85957206	missense	probably benign	0.00
IGL01410:Vmn2r74	APN	7	85961292	missense	possibly damaging	0.83
IGL01827:Vmn2r74	APN	7	85957592	missense	probably benign	0.00
IGL02094:Vmn2r74	APN	7	85961461	missense	probably benign	0.01
IGL02252:Vmn2r74	APN	7	85957323	missense	probably benign	0.41
IGL02349:Vmn2r74	APN	7	85952516	missense	probably damaging	0.99
IGL02438:Vmn2r74	APN	7	85952616	missense	probably damaging	0.98
IGL02554:Vmn2r74	APN	7	85957373	missense	probably benign	0.00
IGL03036:Vmn2r74	APN	7	85952692	nonsense	probably null
IGL03370:Vmn2r74	APN	7	85958057	missense	probably benign
R0115:Vmn2r74	UTSW	7	85957356	missense	probably benign	0.00
R0333:Vmn2r74	UTSW	7	85952283	missense	probably benign	0.06
R0415:Vmn2r74	UTSW	7	85961410	missense	probably damaging	1.00
R0571:Vmn2r74	UTSW	7	85952421	missense	probably damaging	1.00
R0626:Vmn2r74	UTSW	7	85961309	nonsense	probably null
R0659:Vmn2r74	UTSW	7	85955914	splice site	probably benign
R1202:Vmn2r74	UTSW	7	85961337	missense	possibly damaging	0.83
R1473:Vmn2r74	UTSW	7	85961410	missense	probably damaging	1.00
R1908:Vmn2r74	UTSW	7	85952442	missense	probably benign
R2079:Vmn2r74	UTSW	7	85957175	missense	probably benign	0.00
R2368:Vmn2r74	UTSW	7	85961314	missense	probably benign	0.39
R3782:Vmn2r74	UTSW	7	85956114	missense	probably benign	0.01
R3824:Vmn2r74	UTSW	7	85958258	missense	probably damaging	1.00
R3977:Vmn2r74	UTSW	7	85958137	missense	probably benign	0.01
R4182:Vmn2r74	UTSW	7	85957187	missense	possibly damaging	0.87
R4289:Vmn2r74	UTSW	7	85957354	missense	probably benign
R4294:Vmn2r74	UTSW	7	85957416	missense	probably benign	0.14
R4645:Vmn2r74	UTSW	7	85957109	missense	probably benign
R4646:Vmn2r74	UTSW	7	85957574	missense	probably benign	0.42
R4655:Vmn2r74	UTSW	7	85961347	missense	probably benign
R4901:Vmn2r74	UTSW	7	85955991	nonsense	probably null
R5532:Vmn2r74	UTSW	7	85951989	missense	probably benign	0.32
R5642:Vmn2r74	UTSW	7	85957380	missense	probably benign	0.00
R5913:Vmn2r74	UTSW	7	85951890	missense	probably damaging	0.98
R6035:Vmn2r74	UTSW	7	85951890	missense	probably damaging	0.98
R6035:Vmn2r74	UTSW	7	85951890	missense	probably damaging	0.98
R6039:Vmn2r74	UTSW	7	85958318	critical splice acceptor site	probably null
R6039:Vmn2r74	UTSW	7	85958318	critical splice acceptor site	probably null
R6170:Vmn2r74	UTSW	7	85957140	missense	probably benign	0.03
R6232:Vmn2r74	UTSW	7	85958290	missense	possibly damaging	0.82
R6238:Vmn2r74	UTSW	7	85952072	missense	probably damaging	1.00
R6468:Vmn2r74	UTSW	7	85961391	missense	probably benign	0.34
R6732:Vmn2r74	UTSW	7	85957550	missense	probably damaging	1.00
R6816:Vmn2r74	UTSW	7	85961413	nonsense	probably null
R6836:Vmn2r74	UTSW	7	85957422	missense	probably benign	0.00
R6995:Vmn2r74	UTSW	7	85952735	missense	probably benign	0.01
R6995:Vmn2r74	UTSW	7	85957652	critical splice acceptor site	probably null
R7186:Vmn2r74	UTSW	7	85951942	nonsense	probably null
R7246:Vmn2r74	UTSW	7	85955965	missense	probably benign
R7374:Vmn2r74	UTSW	7	85957422	missense	probably benign	0.02
R7505:Vmn2r74	UTSW	7	85957071	nonsense	probably null
R7525:Vmn2r74	UTSW	7	85961302	missense	probably benign
R7569:Vmn2r74	UTSW	7	85952336	missense	probably damaging	0.99
R7644:Vmn2r74	UTSW	7	85957538	missense	probably benign	0.11
R7956:Vmn2r74	UTSW	7	85955958	missense	probably benign	0.09
R8119:Vmn2r74	UTSW	7	85961482	start codon destroyed	probably null	0.08
R8131:Vmn2r74	UTSW	7	85952735	missense	probably benign	0.01
R8147:Vmn2r74	UTSW	7	85956019	nonsense	probably null
R8181:Vmn2r74	UTSW	7	85956116	missense	probably damaging	1.00
R8184:Vmn2r74	UTSW	7	85952246	missense	probably benign	0.00
R8375:Vmn2r74	UTSW	7	85952706	missense	possibly damaging	0.64
R8948:Vmn2r74	UTSW	7	85957361	missense	probably damaging	1.00
R8950:Vmn2r74	UTSW	7	85957361	missense	probably damaging	1.00
R9033:Vmn2r74	UTSW	7	85957206	missense	probably benign
R9342:Vmn2r74	UTSW	7	85957416	missense	probably benign	0.14
R9578:Vmn2r74	UTSW	7	85956893	missense	probably benign	0.01
R9607:Vmn2r74	UTSW	7	85961411	missense	probably benign	0.02
R9776:Vmn2r74	UTSW	7	85956004	missense	possibly damaging	0.70
Z1176:Vmn2r74	UTSW	7	85955627	missense	probably damaging	1.00
Z31818:Vmn2r74	UTSW	7	85955521	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- GGAGAAGTTCCCAGCCAAATTCC -3'
(R):5'- CCTTTGGGTAAAGCTCTGGC -3'

Sequencing Primer
(F):5'- CCACAAAGAATCAGCTGAATTATTG -3'
(R):5'- TCTTGTGTTGGTTGTCTTCCTGAAAC -3'

Posted On

2018-02-28