Incidental Mutation 'R6255:Ppfibp2'
ID 506058
Institutional Source Beutler Lab
Gene Symbol Ppfibp2
Ensembl Gene ENSMUSG00000036528
Gene Name PTPRF interacting protein, binding protein 2 (liprin beta 2)
Synonyms Cclp1, liprin beta 2
MMRRC Submission 044372-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6255 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 107595207-107748583 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107681762 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 94 (S94P)
Ref Sequence ENSEMBL: ENSMUSP00000146889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040056] [ENSMUST00000098134] [ENSMUST00000208956]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000040056
AA Change: S94P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000042574
Gene: ENSMUSG00000036528
AA Change: S94P

Pfam:Integrase_DNA 192 256 3.4e-24 PFAM
low complexity region 357 374 N/A INTRINSIC
SAM 561 628 1.86e-12 SMART
SAM 633 699 4.07e-9 SMART
SAM 721 793 9.22e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098134
AA Change: S94P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000095738
Gene: ENSMUSG00000036528
AA Change: S94P

PDB:3QH9|A 185 265 2e-26 PDB
low complexity region 357 374 N/A INTRINSIC
SAM 550 617 1.86e-12 SMART
SAM 622 688 4.07e-9 SMART
SAM 710 782 9.22e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208504
Predicted Effect probably damaging
Transcript: ENSMUST00000208956
AA Change: S94P

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.0786 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. The encoded protein is a beta liprin and plays a role in axon guidance and neuronal synapse development by recruiting LAR protein-tyrosine phosphatases to the plasma membrane. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,123 V7E possibly damaging Het
Aars2 G A 17: 45,514,609 G333S probably damaging Het
Aen T A 7: 78,905,844 I85N probably damaging Het
Ahnak C A 19: 9,008,025 H2224Q possibly damaging Het
Aldh18a1 C T 19: 40,580,043 R41H possibly damaging Het
Bpifb9b T A 2: 154,309,364 W2R probably damaging Het
Caprin2 A G 6: 148,877,892 I139T probably benign Het
Cdhr3 T A 12: 33,053,475 N381I probably damaging Het
Cecr2 A G 6: 120,758,050 Y721C probably damaging Het
Cherp G T 8: 72,470,881 A125D probably damaging Het
Cped1 G A 6: 22,138,715 probably null Het
Ctdp1 T A 18: 80,459,297 probably null Het
Cyp2c55 T C 19: 39,018,667 I169T probably benign Het
Cyp4a31 T C 4: 115,574,920 L418P possibly damaging Het
Efcab7 T C 4: 99,829,390 probably benign Het
Efcab8 T C 2: 153,810,268 W466R possibly damaging Het
Ehd3 C A 17: 73,805,413 N57K probably benign Het
Ern2 C A 7: 122,173,272 K654N probably damaging Het
Fbxo18 A T 2: 11,748,446 F879L probably benign Het
Gde1 T C 7: 118,691,781 D92G probably null Het
Gm4788 A T 1: 139,753,011 C256* probably null Het
Heatr5b A G 17: 78,803,434 V995A probably damaging Het
Ifrd2 A G 9: 107,592,091 E346G probably damaging Het
Ism1 AACGGACCCGTTCTTGTGGCTATGCA AA 2: 139,746,042 probably benign Het
Itgb4 T C 11: 115,998,137 V1102A possibly damaging Het
Itgb6 A T 2: 60,605,276 I710N probably damaging Het
Kif1a T C 1: 93,019,983 K1578E probably damaging Het
Kif9 T C 9: 110,517,834 probably null Het
Kitl T C 10: 100,089,233 *57Q probably null Het
Lrat C A 3: 82,903,505 V70F probably damaging Het
Lrrc9 T A 12: 72,487,023 M1022K probably benign Het
Muc16 T C 9: 18,655,599 T1875A unknown Het
Mup4 T A 4: 59,957,890 N171I probably damaging Het
Npas4 G A 19: 4,986,375 T587I probably damaging Het
Oas3 A G 5: 120,771,230 V217A probably benign Het
Olfr786 A G 10: 129,437,688 N292S possibly damaging Het
Osbp C A 19: 11,977,953 A323D possibly damaging Het
Panx2 G A 15: 89,067,618 R96H probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Piezo2 T C 18: 63,121,270 R385G possibly damaging Het
Pkn2 T C 3: 142,811,599 T476A probably damaging Het
Plekha4 T C 7: 45,553,802 probably benign Het
Pramel7 T A 2: 87,489,663 I429L probably benign Het
Rif1 A G 2: 52,085,053 K325E probably damaging Het
Ror2 T C 13: 53,110,542 Y826C probably damaging Het
Rsph10b G A 5: 143,959,746 G19R probably damaging Het
Slc20a1 A G 2: 129,208,004 N361D probably damaging Het
Slc26a9 A G 1: 131,763,909 D630G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Trank1 T C 9: 111,352,246 probably null Het
Tspan10 T A 11: 120,444,542 C159* probably null Het
Uba6 G A 5: 86,164,765 T23I probably benign Het
Vmn2r74 T C 7: 85,952,451 T660A possibly damaging Het
Vwa5b1 T C 4: 138,578,672 N905S probably benign Het
Zfp831 T C 2: 174,646,421 L963P possibly damaging Het
Zfp990 T A 4: 145,537,789 N452K probably benign Het
Other mutations in Ppfibp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Ppfibp2 APN 7 107708805 missense probably damaging 1.00
IGL00429:Ppfibp2 APN 7 107697594 missense probably benign 0.18
IGL00785:Ppfibp2 APN 7 107737887 missense probably benign
IGL00821:Ppfibp2 APN 7 107729876 missense probably damaging 1.00
IGL01295:Ppfibp2 APN 7 107747539 unclassified probably benign
IGL01361:Ppfibp2 APN 7 107744301 splice site probably null
IGL02115:Ppfibp2 APN 7 107739318 unclassified probably benign
IGL02323:Ppfibp2 APN 7 107738629 missense probably damaging 1.00
IGL02458:Ppfibp2 APN 7 107742964 missense probably damaging 1.00
IGL02731:Ppfibp2 APN 7 107746422 missense possibly damaging 0.92
IGL03343:Ppfibp2 APN 7 107737919 nonsense probably null
R0142:Ppfibp2 UTSW 7 107744177 missense probably damaging 1.00
R0555:Ppfibp2 UTSW 7 107729174 missense probably damaging 1.00
R0630:Ppfibp2 UTSW 7 107738599 critical splice acceptor site probably null
R1374:Ppfibp2 UTSW 7 107685988 splice site probably benign
R1668:Ppfibp2 UTSW 7 107729892 missense probably damaging 1.00
R1731:Ppfibp2 UTSW 7 107740589 missense probably damaging 1.00
R1830:Ppfibp2 UTSW 7 107637297 missense probably damaging 1.00
R1902:Ppfibp2 UTSW 7 107746378 missense probably damaging 1.00
R2061:Ppfibp2 UTSW 7 107739230 missense probably damaging 1.00
R2929:Ppfibp2 UTSW 7 107697651 missense probably damaging 0.99
R3777:Ppfibp2 UTSW 7 107729189 missense probably benign 0.00
R3778:Ppfibp2 UTSW 7 107729189 missense probably benign 0.00
R4839:Ppfibp2 UTSW 7 107742985 missense probably damaging 1.00
R4879:Ppfibp2 UTSW 7 107729183 missense probably benign 0.01
R5643:Ppfibp2 UTSW 7 107737890 missense probably damaging 1.00
R5773:Ppfibp2 UTSW 7 107685872 missense possibly damaging 0.74
R6356:Ppfibp2 UTSW 7 107681769 missense probably benign 0.01
R6843:Ppfibp2 UTSW 7 107727731 missense probably benign 0.00
R6889:Ppfibp2 UTSW 7 107737981 missense possibly damaging 0.94
R7051:Ppfibp2 UTSW 7 107717718 missense probably damaging 1.00
R7194:Ppfibp2 UTSW 7 107722980 critical splice donor site probably null
R7654:Ppfibp2 UTSW 7 107738611 missense probably damaging 0.99
R7678:Ppfibp2 UTSW 7 107716666 missense probably damaging 0.98
R7895:Ppfibp2 UTSW 7 107721317 splice site probably null
R8385:Ppfibp2 UTSW 7 107697687 missense probably benign 0.44
R8434:Ppfibp2 UTSW 7 107728750 critical splice donor site probably null
R8691:Ppfibp2 UTSW 7 107747578 missense probably damaging 0.99
R8695:Ppfibp2 UTSW 7 107685856 splice site probably benign
R8700:Ppfibp2 UTSW 7 107746395 missense possibly damaging 0.94
R8755:Ppfibp2 UTSW 7 107744225 missense probably damaging 1.00
R9172:Ppfibp2 UTSW 7 107738318 nonsense probably null
R9182:Ppfibp2 UTSW 7 107708846 missense possibly damaging 0.72
R9355:Ppfibp2 UTSW 7 107722962 missense probably benign 0.00
R9545:Ppfibp2 UTSW 7 107738297 missense probably damaging 1.00
RF022:Ppfibp2 UTSW 7 107697610 missense probably damaging 1.00
Z1177:Ppfibp2 UTSW 7 107743050 missense possibly damaging 0.85
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2018-02-28