Incidental Mutation 'R6255:Ern2'
ID506060
Institutional Source Beutler Lab
Gene Symbol Ern2
Ensembl Gene ENSMUSG00000030866
Gene Nameendoplasmic reticulum (ER) to nucleus signalling 2
SynonymsIre1b
MMRRC Submission 044372-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R6255 (G1)
Quality Score163.009
Status Validated
Chromosome7
Chromosomal Location122169893-122186207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 122173272 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 654 (K654N)
Ref Sequence ENSEMBL: ENSMUSP00000033153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033153] [ENSMUST00000033154] [ENSMUST00000206198]
Predicted Effect probably damaging
Transcript: ENSMUST00000033153
AA Change: K654N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033153
Gene: ENSMUSG00000030866
AA Change: K654N

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
PQQ 33 64 5.5e-8 SMART
PQQ 115 147 4.7e-4 SMART
PQQ 148 180 6.1e-2 SMART
PQQ 192 223 6.2e-3 SMART
low complexity region 449 461 N/A INTRINSIC
S_TKc 508 768 2.5e-11 SMART
PUG 831 888 9e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000033154
SMART Domains Protein: ENSMUSP00000033154
Gene: ENSMUSG00000030867

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 20 35 N/A INTRINSIC
S_TKc 53 305 7.36e-95 SMART
low complexity region 354 365 N/A INTRINSIC
Pfam:POLO_box 418 479 4.4e-24 PFAM
Pfam:POLO_box 516 583 3.1e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000206198
AA Change: K653N

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.5307 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for disruption of this gene are generally normal but display an increased susceptibility to intestinal inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,123 V7E possibly damaging Het
Aars2 G A 17: 45,514,609 G333S probably damaging Het
Aen T A 7: 78,905,844 I85N probably damaging Het
Ahnak C A 19: 9,008,025 H2224Q possibly damaging Het
Aldh18a1 C T 19: 40,580,043 R41H possibly damaging Het
Bpifb9b T A 2: 154,309,364 W2R probably damaging Het
Caprin2 A G 6: 148,877,892 I139T probably benign Het
Cdhr3 T A 12: 33,053,475 N381I probably damaging Het
Cecr2 A G 6: 120,758,050 Y721C probably damaging Het
Cherp G T 8: 72,470,881 A125D probably damaging Het
Cped1 G A 6: 22,138,715 probably null Het
Ctdp1 T A 18: 80,459,297 probably null Het
Cyp2c55 T C 19: 39,018,667 I169T probably benign Het
Cyp4a31 T C 4: 115,574,920 L418P possibly damaging Het
Efcab7 T C 4: 99,829,390 probably benign Het
Efcab8 T C 2: 153,810,268 W466R possibly damaging Het
Ehd3 C A 17: 73,805,413 N57K probably benign Het
Fbxo18 A T 2: 11,748,446 F879L probably benign Het
Gde1 T C 7: 118,691,781 D92G probably null Het
Gm4788 A T 1: 139,753,011 C256* probably null Het
Heatr5b A G 17: 78,803,434 V995A probably damaging Het
Ifrd2 A G 9: 107,592,091 E346G probably damaging Het
Ism1 AACGGACCCGTTCTTGTGGCTATGCA AA 2: 139,746,042 probably benign Het
Itgb4 T C 11: 115,998,137 V1102A possibly damaging Het
Itgb6 A T 2: 60,605,276 I710N probably damaging Het
Kif1a T C 1: 93,019,983 K1578E probably damaging Het
Kif9 T C 9: 110,517,834 probably null Het
Kitl T C 10: 100,089,233 *57Q probably null Het
Lrat C A 3: 82,903,505 V70F probably damaging Het
Lrrc9 T A 12: 72,487,023 M1022K probably benign Het
Muc16 T C 9: 18,655,599 T1875A unknown Het
Mup4 T A 4: 59,957,890 N171I probably damaging Het
Npas4 G A 19: 4,986,375 T587I probably damaging Het
Oas3 A G 5: 120,771,230 V217A probably benign Het
Olfr786 A G 10: 129,437,688 N292S possibly damaging Het
Osbp C A 19: 11,977,953 A323D possibly damaging Het
Panx2 G A 15: 89,067,618 R96H probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Piezo2 T C 18: 63,121,270 R385G possibly damaging Het
Pkn2 T C 3: 142,811,599 T476A probably damaging Het
Plekha4 T C 7: 45,553,802 probably benign Het
Ppfibp2 T C 7: 107,681,762 S94P probably damaging Het
Pramel7 T A 2: 87,489,663 I429L probably benign Het
Rif1 A G 2: 52,085,053 K325E probably damaging Het
Ror2 T C 13: 53,110,542 Y826C probably damaging Het
Rsph10b G A 5: 143,959,746 G19R probably damaging Het
Slc20a1 A G 2: 129,208,004 N361D probably damaging Het
Slc26a9 A G 1: 131,763,909 D630G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Trank1 T C 9: 111,352,246 probably null Het
Tspan10 T A 11: 120,444,542 C159* probably null Het
Uba6 G A 5: 86,164,765 T23I probably benign Het
Vmn2r74 T C 7: 85,952,451 T660A possibly damaging Het
Vwa5b1 T C 4: 138,578,672 N905S probably benign Het
Zfp831 T C 2: 174,646,421 L963P possibly damaging Het
Zfp990 T A 4: 145,537,789 N452K probably benign Het
Other mutations in Ern2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ern2 APN 7 122170092 missense probably damaging 0.99
IGL01324:Ern2 APN 7 122183190 missense possibly damaging 0.88
IGL02185:Ern2 APN 7 122173375 splice site probably benign
IGL02738:Ern2 APN 7 122182899 missense probably damaging 0.99
IGL02750:Ern2 APN 7 122181406 splice site probably benign
IGL03247:Ern2 APN 7 122171671 missense probably benign 0.02
ernie UTSW 7 122171661 critical splice donor site probably null
Ernie2 UTSW 7 122180862 splice site probably benign
ernie3 UTSW 7 122173819 critical splice acceptor site probably null
R0165:Ern2 UTSW 7 122179779 missense probably benign 0.02
R0785:Ern2 UTSW 7 122171661 critical splice donor site probably null
R0801:Ern2 UTSW 7 122180862 splice site probably benign
R1345:Ern2 UTSW 7 122177770 missense probably damaging 1.00
R1649:Ern2 UTSW 7 122177400 missense probably damaging 1.00
R1747:Ern2 UTSW 7 122173819 critical splice acceptor site probably null
R1747:Ern2 UTSW 7 122173820 critical splice acceptor site probably null
R1846:Ern2 UTSW 7 122176536 missense probably benign 0.32
R1899:Ern2 UTSW 7 122183842 splice site probably benign
R1986:Ern2 UTSW 7 122171529 missense probably benign 0.06
R2055:Ern2 UTSW 7 122183945 missense possibly damaging 0.84
R2329:Ern2 UTSW 7 122173487 missense possibly damaging 0.82
R2351:Ern2 UTSW 7 122171508 missense probably damaging 0.97
R2894:Ern2 UTSW 7 122181587 missense possibly damaging 0.94
R3176:Ern2 UTSW 7 122180964 missense possibly damaging 0.89
R3276:Ern2 UTSW 7 122180964 missense possibly damaging 0.89
R3945:Ern2 UTSW 7 122176530 missense probably benign 0.10
R4303:Ern2 UTSW 7 122177846 critical splice acceptor site probably null
R4874:Ern2 UTSW 7 122176587 missense probably benign 0.28
R4943:Ern2 UTSW 7 122173258 missense possibly damaging 0.95
R5184:Ern2 UTSW 7 122179959 missense probably benign 0.03
R5629:Ern2 UTSW 7 122170166 missense probably damaging 1.00
R5770:Ern2 UTSW 7 122179907 missense possibly damaging 0.92
R6272:Ern2 UTSW 7 122176646 missense probably benign 0.05
R6277:Ern2 UTSW 7 122186107 missense probably benign
R6624:Ern2 UTSW 7 122177783 missense probably benign 0.00
R6940:Ern2 UTSW 7 122186146 missense probably benign 0.01
R7491:Ern2 UTSW 7 122170533 missense probably damaging 1.00
R7544:Ern2 UTSW 7 122173199 missense probably benign 0.06
R7555:Ern2 UTSW 7 122170241 missense probably damaging 1.00
R7843:Ern2 UTSW 7 122173708 missense probably damaging 1.00
R7926:Ern2 UTSW 7 122173708 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACTGTCAGGAGCGGATGG -3'
(R):5'- TAGGTACCGTCTTGCTTCCAG -3'

Sequencing Primer
(F):5'- GAGATGCTTTCTTCCCAAGGCAAG -3'
(R):5'- GTACCGTCTTGCTTCCAGTCCTTAG -3'
Posted On2018-02-28