Mutagenetix > Incidental Mutation

Incidental Mutation 'R6255:Kif9'

506063

Institutional Source

Beutler Lab

Gene Symbol

Kif9

Ensembl Gene

ENSMUSG00000032489

Gene Name

kinesin family member 9

Synonyms

MMRRC Submission

044372-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R6255 (G1)

Quality Score

156.008

Status

Validated

Chromosome

Chromosomal Location

110476958-110525179 bp(+) (GRCm38)

Type of Mutation

splice site (3211 bp from exon)

DNA Base Change (assembly)

T to C at 110517834 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000142689 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061155] [ENSMUST00000084952] [ENSMUST00000197248] [ENSMUST00000198043]

AlphaFold

Q9WV04

Predicted Effect

probably null
Transcript: ENSMUST00000061155

SMART Domains

Protein: ENSMUSP00000057896
Gene: ENSMUSG00000032489

Domain	Start	End	E-Value	Type
KISc	4	348	1.25e-120	SMART
low complexity region	359	371	N/A	INTRINSIC
Blast:KISc	372	608	7e-19	BLAST
low complexity region	651	668	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000084952

SMART Domains

Protein: ENSMUSP00000082016
Gene: ENSMUSG00000032489

Domain	Start	End	E-Value	Type
KISc	4	348	1.25e-120	SMART
low complexity region	359	371	N/A	INTRINSIC
Blast:KISc	372	608	7e-19	BLAST
low complexity region	651	668	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000197248

SMART Domains

Protein: ENSMUSP00000142734
Gene: ENSMUSG00000032489

Domain	Start	End	E-Value	Type
KISc	4	348	1.25e-120	SMART
low complexity region	359	371	N/A	INTRINSIC
Blast:KISc	372	608	6e-19	BLAST
low complexity region	651	668	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000198043

SMART Domains

Protein: ENSMUSP00000142689
Gene: ENSMUSG00000032489

Domain	Start	End	E-Value	Type
KISc	4	348	1.25e-120	SMART
low complexity region	359	371	N/A	INTRINSIC
Blast:KISc	372	476	5e-14	BLAST
low complexity region	489	501	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (58/58)

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	T	A	13: 119,466,123	V7E	possibly damaging	Het
Aars2	G	A	17: 45,514,609	G333S	probably damaging	Het
Aen	T	A	7: 78,905,844	I85N	probably damaging	Het
Ahnak	C	A	19: 9,008,025	H2224Q	possibly damaging	Het
Aldh18a1	C	T	19: 40,580,043	R41H	possibly damaging	Het
Bpifb9b	T	A	2: 154,309,364	W2R	probably damaging	Het
Caprin2	A	G	6: 148,877,892	I139T	probably benign	Het
Cdhr3	T	A	12: 33,053,475	N381I	probably damaging	Het
Cecr2	A	G	6: 120,758,050	Y721C	probably damaging	Het
Cherp	G	T	8: 72,470,881	A125D	probably damaging	Het
Cped1	G	A	6: 22,138,715		probably null	Het
Ctdp1	T	A	18: 80,459,297		probably null	Het
Cyp2c55	T	C	19: 39,018,667	I169T	probably benign	Het
Cyp4a31	T	C	4: 115,574,920	L418P	possibly damaging	Het
Efcab7	T	C	4: 99,829,390		probably benign	Het
Efcab8	T	C	2: 153,810,268	W466R	possibly damaging	Het
Ehd3	C	A	17: 73,805,413	N57K	probably benign	Het
Ern2	C	A	7: 122,173,272	K654N	probably damaging	Het
Fbxo18	A	T	2: 11,748,446	F879L	probably benign	Het
Gde1	T	C	7: 118,691,781	D92G	probably null	Het
Gm4788	A	T	1: 139,753,011	C256*	probably null	Het
Heatr5b	A	G	17: 78,803,434	V995A	probably damaging	Het
Ifrd2	A	G	9: 107,592,091	E346G	probably damaging	Het
Ism1	AACGGACCCGTTCTTGTGGCTATGCA	AA	2: 139,746,042		probably benign	Het
Itgb4	T	C	11: 115,998,137	V1102A	possibly damaging	Het
Itgb6	A	T	2: 60,605,276	I710N	probably damaging	Het
Kif1a	T	C	1: 93,019,983	K1578E	probably damaging	Het
Kitl	T	C	10: 100,089,233	*57Q	probably null	Het
Lrat	C	A	3: 82,903,505	V70F	probably damaging	Het
Lrrc9	T	A	12: 72,487,023	M1022K	probably benign	Het
Muc16	T	C	9: 18,655,599	T1875A	unknown	Het
Mup4	T	A	4: 59,957,890	N171I	probably damaging	Het
Npas4	G	A	19: 4,986,375	T587I	probably damaging	Het
Oas3	A	G	5: 120,771,230	V217A	probably benign	Het
Olfr786	A	G	10: 129,437,688	N292S	possibly damaging	Het
Osbp	C	A	19: 11,977,953	A323D	possibly damaging	Het
Panx2	G	A	15: 89,067,618	R96H	probably damaging	Het
Pcdhb18	G	A	18: 37,490,484	R289Q	probably benign	Het
Piezo2	T	C	18: 63,121,270	R385G	possibly damaging	Het
Pkn2	T	C	3: 142,811,599	T476A	probably damaging	Het
Plekha4	T	C	7: 45,553,802		probably benign	Het
Ppfibp2	T	C	7: 107,681,762	S94P	probably damaging	Het
Pramel7	T	A	2: 87,489,663	I429L	probably benign	Het
Rif1	A	G	2: 52,085,053	K325E	probably damaging	Het
Ror2	T	C	13: 53,110,542	Y826C	probably damaging	Het
Rsph10b	G	A	5: 143,959,746	G19R	probably damaging	Het
Slc20a1	A	G	2: 129,208,004	N361D	probably damaging	Het
Slc26a9	A	G	1: 131,763,909	D630G	probably benign	Het
Smtnl2	G	A	11: 72,401,399	A274V	probably damaging	Het
Trank1	T	C	9: 111,352,246		probably null	Het
Tspan10	T	A	11: 120,444,542	C159*	probably null	Het
Uba6	G	A	5: 86,164,765	T23I	probably benign	Het
Vmn2r74	T	C	7: 85,952,451	T660A	possibly damaging	Het
Vwa5b1	T	C	4: 138,578,672	N905S	probably benign	Het
Zfp831	T	C	2: 174,646,421	L963P	possibly damaging	Het
Zfp990	T	A	4: 145,537,789	N452K	probably benign	Het

Other mutations in Kif9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01630:Kif9	APN	9	110485070	missense	probably benign	0.03
IGL02273:Kif9	APN	9	110510470	missense	probably damaging	0.99
IGL02818:Kif9	APN	9	110485149	missense	probably damaging	1.00
R0034:Kif9	UTSW	9	110519611	missense	probably benign	0.23
R0034:Kif9	UTSW	9	110519611	missense	probably benign	0.23
R0047:Kif9	UTSW	9	110485038	missense	probably benign	0.05
R0047:Kif9	UTSW	9	110485038	missense	probably benign	0.05
R0137:Kif9	UTSW	9	110485038	missense	probably damaging	1.00
R0594:Kif9	UTSW	9	110511340	missense	probably benign	0.22
R1503:Kif9	UTSW	9	110510438	missense	possibly damaging	0.89
R1657:Kif9	UTSW	9	110489966	missense	possibly damaging	0.82
R1826:Kif9	UTSW	9	110517633	missense	probably benign	0.34
R1856:Kif9	UTSW	9	110517719	missense	probably null	1.00
R2076:Kif9	UTSW	9	110485032	splice site	probably null
R3407:Kif9	UTSW	9	110519140	missense	probably damaging	1.00
R4247:Kif9	UTSW	9	110495959	critical splice donor site	probably null
R4487:Kif9	UTSW	9	110494484	missense	probably null	1.00
R4515:Kif9	UTSW	9	110489867	missense	probably benign	0.38
R4880:Kif9	UTSW	9	110501635	missense	probably damaging	0.98
R5024:Kif9	UTSW	9	110483093	missense	possibly damaging	0.81
R5093:Kif9	UTSW	9	110489897	missense	probably damaging	1.00
R5181:Kif9	UTSW	9	110521268	missense	probably damaging	1.00
R5362:Kif9	UTSW	9	110489944	missense	probably damaging	0.99
R5379:Kif9	UTSW	9	110521303	missense	probably benign	0.00
R5628:Kif9	UTSW	9	110514553	nonsense	probably null
R5653:Kif9	UTSW	9	110524931	missense	probably damaging	1.00
R5698:Kif9	UTSW	9	110510464	missense	probably benign
R5758:Kif9	UTSW	9	110489879	missense	probably damaging	1.00
R5986:Kif9	UTSW	9	110490026	missense	probably benign	0.05
R6103:Kif9	UTSW	9	110489849	missense	possibly damaging	0.82
R6247:Kif9	UTSW	9	110488544	missense	possibly damaging	0.78
R6991:Kif9	UTSW	9	110494622	missense	probably damaging	1.00
R7113:Kif9	UTSW	9	110506664	missense	probably damaging	1.00
R7459:Kif9	UTSW	9	110519041	missense	probably damaging	1.00
R7593:Kif9	UTSW	9	110521353	missense	possibly damaging	0.54
R7892:Kif9	UTSW	9	110514614	missense	not run
R8050:Kif9	UTSW	9	110519140	missense	probably damaging	1.00
R8370:Kif9	UTSW	9	110488613	missense	probably damaging	1.00
R8549:Kif9	UTSW	9	110514419	splice site	probably null
R8751:Kif9	UTSW	9	110501656	missense	probably benign	0.03
R8830:Kif9	UTSW	9	110524930	missense	probably damaging	1.00
R9489:Kif9	UTSW	9	110517642	missense	probably benign	0.01
R9519:Kif9	UTSW	9	110521276	missense	probably damaging	0.98
R9605:Kif9	UTSW	9	110517642	missense	probably benign	0.01
R9776:Kif9	UTSW	9	110521330	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CGCCATCAAGCAGGAGATTG -3'
(R):5'- ACCTTTTCAATGAACTGCCTAGC -3'

Sequencing Primer
(F):5'- TTGATGAGACCAAAGATGCACTC -3'
(R):5'- CTACTGAGCCTCCAGTGTGTG -3'

Posted On

2018-02-28