Mutagenetix > Incidental Mutation

Incidental Mutation 'R6255:Kitl'

506065

Institutional Source

Beutler Lab

Gene Symbol

Kitl

Ensembl Gene

ENSMUSG00000019966

Gene Name

kit ligand

Synonyms

Gb, grizzle-belly, Mgf, SCF, SF, Sl, SLF, Steel, Steel factor, stem cell factor

MMRRC Submission

044372-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.280) question?

Stock #

R6255 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100015630-100100416 bp(+) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

T to C at 100089233 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Glutamine at position 57 (*57Q)

Ref Sequence

ENSEMBL: ENSMUSP00000151554 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020129] [ENSMUST00000105283] [ENSMUST00000218200]

AlphaFold

P20826

Predicted Effect

probably null
Transcript: ENSMUST00000020129
AA Change: *246Q

SMART Domains

Protein: ENSMUSP00000020129
Gene: ENSMUSG00000019966
AA Change: *246Q

Domain	Start	End	E-Value	Type
Pfam:SCF	1	176	5.7e-102	PFAM
Pfam:SCF	173	245	1.7e-36	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000105283
AA Change: *274Q

SMART Domains

Protein: ENSMUSP00000100920
Gene: ENSMUSG00000019966
AA Change: *274Q

Domain	Start	End	E-Value	Type
Pfam:SCF	1	273	2.3e-157	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000218200
AA Change: *57Q

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219881

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene affect migration of embryonic stem cells and cause similar phenotypes to mutations in its receptor gene (Kit). Mutants show mild to severe defects in pigmentation, hemopoiesis and reproduction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	T	A	13: 119,466,123	V7E	possibly damaging	Het
Aars2	G	A	17: 45,514,609	G333S	probably damaging	Het
Aen	T	A	7: 78,905,844	I85N	probably damaging	Het
Ahnak	C	A	19: 9,008,025	H2224Q	possibly damaging	Het
Aldh18a1	C	T	19: 40,580,043	R41H	possibly damaging	Het
Bpifb9b	T	A	2: 154,309,364	W2R	probably damaging	Het
Caprin2	A	G	6: 148,877,892	I139T	probably benign	Het
Cdhr3	T	A	12: 33,053,475	N381I	probably damaging	Het
Cecr2	A	G	6: 120,758,050	Y721C	probably damaging	Het
Cherp	G	T	8: 72,470,881	A125D	probably damaging	Het
Cped1	G	A	6: 22,138,715		probably null	Het
Ctdp1	T	A	18: 80,459,297		probably null	Het
Cyp2c55	T	C	19: 39,018,667	I169T	probably benign	Het
Cyp4a31	T	C	4: 115,574,920	L418P	possibly damaging	Het
Efcab7	T	C	4: 99,829,390		probably benign	Het
Efcab8	T	C	2: 153,810,268	W466R	possibly damaging	Het
Ehd3	C	A	17: 73,805,413	N57K	probably benign	Het
Ern2	C	A	7: 122,173,272	K654N	probably damaging	Het
Fbxo18	A	T	2: 11,748,446	F879L	probably benign	Het
Gde1	T	C	7: 118,691,781	D92G	probably null	Het
Gm4788	A	T	1: 139,753,011	C256*	probably null	Het
Heatr5b	A	G	17: 78,803,434	V995A	probably damaging	Het
Ifrd2	A	G	9: 107,592,091	E346G	probably damaging	Het
Ism1	AACGGACCCGTTCTTGTGGCTATGCA	AA	2: 139,746,042		probably benign	Het
Itgb4	T	C	11: 115,998,137	V1102A	possibly damaging	Het
Itgb6	A	T	2: 60,605,276	I710N	probably damaging	Het
Kif1a	T	C	1: 93,019,983	K1578E	probably damaging	Het
Kif9	T	C	9: 110,517,834		probably null	Het
Lrat	C	A	3: 82,903,505	V70F	probably damaging	Het
Lrrc9	T	A	12: 72,487,023	M1022K	probably benign	Het
Muc16	T	C	9: 18,655,599	T1875A	unknown	Het
Mup4	T	A	4: 59,957,890	N171I	probably damaging	Het
Npas4	G	A	19: 4,986,375	T587I	probably damaging	Het
Oas3	A	G	5: 120,771,230	V217A	probably benign	Het
Olfr786	A	G	10: 129,437,688	N292S	possibly damaging	Het
Osbp	C	A	19: 11,977,953	A323D	possibly damaging	Het
Panx2	G	A	15: 89,067,618	R96H	probably damaging	Het
Pcdhb18	G	A	18: 37,490,484	R289Q	probably benign	Het
Piezo2	T	C	18: 63,121,270	R385G	possibly damaging	Het
Pkn2	T	C	3: 142,811,599	T476A	probably damaging	Het
Plekha4	T	C	7: 45,553,802		probably benign	Het
Ppfibp2	T	C	7: 107,681,762	S94P	probably damaging	Het
Pramel7	T	A	2: 87,489,663	I429L	probably benign	Het
Rif1	A	G	2: 52,085,053	K325E	probably damaging	Het
Ror2	T	C	13: 53,110,542	Y826C	probably damaging	Het
Rsph10b	G	A	5: 143,959,746	G19R	probably damaging	Het
Slc20a1	A	G	2: 129,208,004	N361D	probably damaging	Het
Slc26a9	A	G	1: 131,763,909	D630G	probably benign	Het
Smtnl2	G	A	11: 72,401,399	A274V	probably damaging	Het
Trank1	T	C	9: 111,352,246		probably null	Het
Tspan10	T	A	11: 120,444,542	C159*	probably null	Het
Uba6	G	A	5: 86,164,765	T23I	probably benign	Het
Vmn2r74	T	C	7: 85,952,451	T660A	possibly damaging	Het
Vwa5b1	T	C	4: 138,578,672	N905S	probably benign	Het
Zfp831	T	C	2: 174,646,421	L963P	possibly damaging	Het
Zfp990	T	A	4: 145,537,789	N452K	probably benign	Het

Other mutations in Kitl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00823:Kitl	APN	10	100087344	splice site	probably benign
IGL02066:Kitl	APN	10	100076882	missense	probably damaging	1.00
IGL03211:Kitl	APN	10	100080859	missense	probably benign	0.19
Gregory	UTSW	10	100076906	critical splice donor site	probably null
mooyah	UTSW	10	100088222	critical splice donor site	probably null
Sandycheeks	UTSW	10	100076906	critical splice donor site	probably null
R0131:Kitl	UTSW	10	100087364	missense	probably benign	0.11
R0131:Kitl	UTSW	10	100087364	missense	probably benign	0.11
R0132:Kitl	UTSW	10	100087364	missense	probably benign	0.11
R1554:Kitl	UTSW	10	100087438	missense	probably benign	0.38
R1649:Kitl	UTSW	10	100064114	missense	probably benign	0.03
R2194:Kitl	UTSW	10	100016037	critical splice donor site	probably null
R2254:Kitl	UTSW	10	100080131	critical splice donor site	probably null
R4877:Kitl	UTSW	10	100080866	missense	probably damaging	1.00
R5135:Kitl	UTSW	10	100088222	critical splice donor site	probably null
R5453:Kitl	UTSW	10	100087385	missense	probably damaging	1.00
R5564:Kitl	UTSW	10	100080024	missense	possibly damaging	0.89
R5832:Kitl	UTSW	10	100080020	missense	probably damaging	1.00
R5971:Kitl	UTSW	10	100076906	critical splice donor site	probably null
R6043:Kitl	UTSW	10	100064085	missense	probably damaging	1.00
R6067:Kitl	UTSW	10	100076906	critical splice donor site	probably null
R6138:Kitl	UTSW	10	100076906	critical splice donor site	probably null
R6450:Kitl	UTSW	10	100087394	start codon destroyed	probably null	0.00
R6588:Kitl	UTSW	10	100064092	missense	probably damaging	1.00
R6951:Kitl	UTSW	10	100051852	missense	probably damaging	1.00
R7315:Kitl	UTSW	10	100016112	missense	unknown
R7368:Kitl	UTSW	10	100016081	missense	probably benign	0.02
R8010:Kitl	UTSW	10	100051903	missense	probably benign	0.22
R8234:Kitl	UTSW	10	100051846	missense	probably damaging	1.00
R9613:Kitl	UTSW	10	100080919	missense	probably damaging	1.00
U15987:Kitl	UTSW	10	100076906	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTAGGACAGGCATGAAGATAAGTTTC -3'
(R):5'- TCGGGGCTCAACTGTGTAAC -3'

Sequencing Primer
(F):5'- CAGGCATGAAGATAAGTTTCCTCTG -3'
(R):5'- CGGGGCTCAACTGTGTAACAATTTC -3'

Posted On

2018-02-28