Incidental Mutation 'R6255:Olfr786'
ID 506066
Institutional Source Beutler Lab
Gene Symbol Olfr786
Ensembl Gene ENSMUSG00000095696
Gene Name olfactory receptor 786
Synonyms GA_x6K02T2PULF-11116958-11117896, MOR111-5
MMRRC Submission 044372-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R6255 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 129427306-129439080 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 129437688 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 292 (N292S)
Ref Sequence ENSEMBL: ENSMUSP00000145099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076508] [ENSMUST00000204529]
AlphaFold Q8VFH8
Predicted Effect possibly damaging
Transcript: ENSMUST00000076508
AA Change: N292S

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075827
Gene: ENSMUSG00000095696
AA Change: N292S

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.9e-53 PFAM
Pfam:7tm_1 39 288 7.3e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204529
AA Change: N292S

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145099
Gene: ENSMUSG00000095696
AA Change: N292S

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.9e-53 PFAM
Pfam:7tm_1 39 288 7.3e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,123 V7E possibly damaging Het
Aars2 G A 17: 45,514,609 G333S probably damaging Het
Aen T A 7: 78,905,844 I85N probably damaging Het
Ahnak C A 19: 9,008,025 H2224Q possibly damaging Het
Aldh18a1 C T 19: 40,580,043 R41H possibly damaging Het
Bpifb9b T A 2: 154,309,364 W2R probably damaging Het
Caprin2 A G 6: 148,877,892 I139T probably benign Het
Cdhr3 T A 12: 33,053,475 N381I probably damaging Het
Cecr2 A G 6: 120,758,050 Y721C probably damaging Het
Cherp G T 8: 72,470,881 A125D probably damaging Het
Cped1 G A 6: 22,138,715 probably null Het
Ctdp1 T A 18: 80,459,297 probably null Het
Cyp2c55 T C 19: 39,018,667 I169T probably benign Het
Cyp4a31 T C 4: 115,574,920 L418P possibly damaging Het
Efcab7 T C 4: 99,829,390 probably benign Het
Efcab8 T C 2: 153,810,268 W466R possibly damaging Het
Ehd3 C A 17: 73,805,413 N57K probably benign Het
Ern2 C A 7: 122,173,272 K654N probably damaging Het
Fbxo18 A T 2: 11,748,446 F879L probably benign Het
Gde1 T C 7: 118,691,781 D92G probably null Het
Gm4788 A T 1: 139,753,011 C256* probably null Het
Heatr5b A G 17: 78,803,434 V995A probably damaging Het
Ifrd2 A G 9: 107,592,091 E346G probably damaging Het
Ism1 AACGGACCCGTTCTTGTGGCTATGCA AA 2: 139,746,042 probably benign Het
Itgb4 T C 11: 115,998,137 V1102A possibly damaging Het
Itgb6 A T 2: 60,605,276 I710N probably damaging Het
Kif1a T C 1: 93,019,983 K1578E probably damaging Het
Kif9 T C 9: 110,517,834 probably null Het
Kitl T C 10: 100,089,233 *57Q probably null Het
Lrat C A 3: 82,903,505 V70F probably damaging Het
Lrrc9 T A 12: 72,487,023 M1022K probably benign Het
Muc16 T C 9: 18,655,599 T1875A unknown Het
Mup4 T A 4: 59,957,890 N171I probably damaging Het
Npas4 G A 19: 4,986,375 T587I probably damaging Het
Oas3 A G 5: 120,771,230 V217A probably benign Het
Osbp C A 19: 11,977,953 A323D possibly damaging Het
Panx2 G A 15: 89,067,618 R96H probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Piezo2 T C 18: 63,121,270 R385G possibly damaging Het
Pkn2 T C 3: 142,811,599 T476A probably damaging Het
Plekha4 T C 7: 45,553,802 probably benign Het
Ppfibp2 T C 7: 107,681,762 S94P probably damaging Het
Pramel7 T A 2: 87,489,663 I429L probably benign Het
Rif1 A G 2: 52,085,053 K325E probably damaging Het
Ror2 T C 13: 53,110,542 Y826C probably damaging Het
Rsph10b G A 5: 143,959,746 G19R probably damaging Het
Slc20a1 A G 2: 129,208,004 N361D probably damaging Het
Slc26a9 A G 1: 131,763,909 D630G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Trank1 T C 9: 111,352,246 probably null Het
Tspan10 T A 11: 120,444,542 C159* probably null Het
Uba6 G A 5: 86,164,765 T23I probably benign Het
Vmn2r74 T C 7: 85,952,451 T660A possibly damaging Het
Vwa5b1 T C 4: 138,578,672 N905S probably benign Het
Zfp831 T C 2: 174,646,421 L963P possibly damaging Het
Zfp990 T A 4: 145,537,789 N452K probably benign Het
Other mutations in Olfr786
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Olfr786 APN 10 129437034 missense possibly damaging 0.95
IGL03027:Olfr786 APN 10 129436911 missense probably damaging 1.00
IGL03177:Olfr786 APN 10 129436815 start codon destroyed probably null 0.82
IGL03216:Olfr786 APN 10 129436937 missense probably damaging 0.98
IGL03265:Olfr786 APN 10 129436925 missense possibly damaging 0.83
R0080:Olfr786 UTSW 10 129437271 missense possibly damaging 0.85
R0082:Olfr786 UTSW 10 129437271 missense possibly damaging 0.85
R0242:Olfr786 UTSW 10 129437348 missense probably damaging 1.00
R0242:Olfr786 UTSW 10 129437348 missense probably damaging 1.00
R0507:Olfr786 UTSW 10 129437288 missense probably benign 0.00
R1432:Olfr786 UTSW 10 129436938 missense probably damaging 1.00
R1563:Olfr786 UTSW 10 129437711 missense probably benign
R2023:Olfr786 UTSW 10 129437582 missense probably damaging 0.99
R2142:Olfr786 UTSW 10 129437747 missense probably benign 0.14
R2279:Olfr786 UTSW 10 129437657 missense probably benign 0.07
R3412:Olfr786 UTSW 10 129437307 missense probably damaging 0.99
R4467:Olfr786 UTSW 10 129437064 missense probably benign 0.04
R4529:Olfr786 UTSW 10 129437418 missense probably benign 0.03
R4843:Olfr786 UTSW 10 129437447 missense probably benign 0.01
R4888:Olfr786 UTSW 10 129437379 missense possibly damaging 0.95
R4890:Olfr786 UTSW 10 129437079 missense probably benign 0.08
R6362:Olfr786 UTSW 10 129436943 missense probably damaging 1.00
R6705:Olfr786 UTSW 10 129437072 missense probably benign 0.00
R7270:Olfr786 UTSW 10 129437450 missense probably benign
R7450:Olfr786 UTSW 10 129437429 missense probably benign 0.00
R7803:Olfr786 UTSW 10 129436931 missense probably damaging 1.00
R7856:Olfr786 UTSW 10 129437016 missense probably damaging 1.00
R8725:Olfr786 UTSW 10 129437465 missense probably benign 0.02
R8727:Olfr786 UTSW 10 129437465 missense probably benign 0.02
R8838:Olfr786 UTSW 10 129437196 missense probably damaging 1.00
R9180:Olfr786 UTSW 10 129436989 missense probably damaging 0.99
X0052:Olfr786 UTSW 10 129437499 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAAGGCCTTTTCCACATGCTC -3'
(R):5'- TGTTCTATCAGAAAGGCCTAAGAAG -3'

Sequencing Primer
(F):5'- ACATGCTCTTCCCACATGATTG -3'
(R):5'- GCCTAAGAAGATAATAGTTGGGTAAG -3'
Posted On 2018-02-28