Incidental Mutation 'R6255:Cdhr3'
ID 506070
Institutional Source Beutler Lab
Gene Symbol Cdhr3
Ensembl Gene ENSMUSG00000035860
Gene Name cadherin-related family member 3
Synonyms 1110049B09Rik
MMRRC Submission 044372-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R6255 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 33033796-33092875 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 33053475 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 381 (N381I)
Ref Sequence ENSEMBL: ENSMUSP00000093449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095774]
AlphaFold Q8BL00
Predicted Effect probably damaging
Transcript: ENSMUST00000095774
AA Change: N381I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093449
Gene: ENSMUSG00000035860
AA Change: N381I

signal peptide 1 19 N/A INTRINSIC
CA 36 131 5.54e-2 SMART
CA 156 234 3.73e-10 SMART
CA 258 343 5.47e-17 SMART
CA 369 459 9.87e-1 SMART
CA 483 564 1.17e-16 SMART
CA 590 683 1.1e0 SMART
transmembrane domain 708 730 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219453
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,123 V7E possibly damaging Het
Aars2 G A 17: 45,514,609 G333S probably damaging Het
Aen T A 7: 78,905,844 I85N probably damaging Het
Ahnak C A 19: 9,008,025 H2224Q possibly damaging Het
Aldh18a1 C T 19: 40,580,043 R41H possibly damaging Het
Bpifb9b T A 2: 154,309,364 W2R probably damaging Het
Caprin2 A G 6: 148,877,892 I139T probably benign Het
Cecr2 A G 6: 120,758,050 Y721C probably damaging Het
Cherp G T 8: 72,470,881 A125D probably damaging Het
Cped1 G A 6: 22,138,715 probably null Het
Ctdp1 T A 18: 80,459,297 probably null Het
Cyp2c55 T C 19: 39,018,667 I169T probably benign Het
Cyp4a31 T C 4: 115,574,920 L418P possibly damaging Het
Efcab7 T C 4: 99,829,390 probably benign Het
Efcab8 T C 2: 153,810,268 W466R possibly damaging Het
Ehd3 C A 17: 73,805,413 N57K probably benign Het
Ern2 C A 7: 122,173,272 K654N probably damaging Het
Fbxo18 A T 2: 11,748,446 F879L probably benign Het
Gde1 T C 7: 118,691,781 D92G probably null Het
Gm4788 A T 1: 139,753,011 C256* probably null Het
Heatr5b A G 17: 78,803,434 V995A probably damaging Het
Ifrd2 A G 9: 107,592,091 E346G probably damaging Het
Ism1 AACGGACCCGTTCTTGTGGCTATGCA AA 2: 139,746,042 probably benign Het
Itgb4 T C 11: 115,998,137 V1102A possibly damaging Het
Itgb6 A T 2: 60,605,276 I710N probably damaging Het
Kif1a T C 1: 93,019,983 K1578E probably damaging Het
Kif9 T C 9: 110,517,834 probably null Het
Kitl T C 10: 100,089,233 *57Q probably null Het
Lrat C A 3: 82,903,505 V70F probably damaging Het
Lrrc9 T A 12: 72,487,023 M1022K probably benign Het
Muc16 T C 9: 18,655,599 T1875A unknown Het
Mup4 T A 4: 59,957,890 N171I probably damaging Het
Npas4 G A 19: 4,986,375 T587I probably damaging Het
Oas3 A G 5: 120,771,230 V217A probably benign Het
Olfr786 A G 10: 129,437,688 N292S possibly damaging Het
Osbp C A 19: 11,977,953 A323D possibly damaging Het
Panx2 G A 15: 89,067,618 R96H probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Piezo2 T C 18: 63,121,270 R385G possibly damaging Het
Pkn2 T C 3: 142,811,599 T476A probably damaging Het
Plekha4 T C 7: 45,553,802 probably benign Het
Ppfibp2 T C 7: 107,681,762 S94P probably damaging Het
Pramel7 T A 2: 87,489,663 I429L probably benign Het
Rif1 A G 2: 52,085,053 K325E probably damaging Het
Ror2 T C 13: 53,110,542 Y826C probably damaging Het
Rsph10b G A 5: 143,959,746 G19R probably damaging Het
Slc20a1 A G 2: 129,208,004 N361D probably damaging Het
Slc26a9 A G 1: 131,763,909 D630G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Trank1 T C 9: 111,352,246 probably null Het
Tspan10 T A 11: 120,444,542 C159* probably null Het
Uba6 G A 5: 86,164,765 T23I probably benign Het
Vmn2r74 T C 7: 85,952,451 T660A possibly damaging Het
Vwa5b1 T C 4: 138,578,672 N905S probably benign Het
Zfp831 T C 2: 174,646,421 L963P possibly damaging Het
Zfp990 T A 4: 145,537,789 N452K probably benign Het
Other mutations in Cdhr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Cdhr3 APN 12 33052209 missense probably benign 0.00
IGL01508:Cdhr3 APN 12 33053428 missense possibly damaging 0.84
IGL02396:Cdhr3 APN 12 33045196 missense possibly damaging 0.64
IGL02414:Cdhr3 APN 12 33042504 missense possibly damaging 0.76
IGL02450:Cdhr3 APN 12 33082225 missense probably benign
IGL02453:Cdhr3 APN 12 33042503 missense probably damaging 0.97
IGL02567:Cdhr3 APN 12 33038901 missense probably benign 0.02
IGL03342:Cdhr3 APN 12 33051055 missense probably benign 0.14
R0022:Cdhr3 UTSW 12 33082264 missense probably damaging 1.00
R0022:Cdhr3 UTSW 12 33082264 missense probably damaging 1.00
R0133:Cdhr3 UTSW 12 33092752 missense possibly damaging 0.94
R0140:Cdhr3 UTSW 12 33080413 missense probably benign 0.00
R0157:Cdhr3 UTSW 12 33061650 missense possibly damaging 0.52
R0762:Cdhr3 UTSW 12 33060301 missense probably benign 0.01
R1421:Cdhr3 UTSW 12 33060292 missense probably damaging 1.00
R1553:Cdhr3 UTSW 12 33042371 missense probably benign 0.10
R1691:Cdhr3 UTSW 12 33082247 missense probably damaging 0.99
R1822:Cdhr3 UTSW 12 33045205 missense probably null 1.00
R1855:Cdhr3 UTSW 12 33060352 missense probably damaging 1.00
R1897:Cdhr3 UTSW 12 33045193 missense possibly damaging 0.81
R2496:Cdhr3 UTSW 12 33049069 missense probably benign 0.01
R2507:Cdhr3 UTSW 12 33038915 missense probably benign
R3155:Cdhr3 UTSW 12 33049153 missense possibly damaging 0.83
R3906:Cdhr3 UTSW 12 33053428 missense probably damaging 0.97
R4005:Cdhr3 UTSW 12 33080356 missense probably damaging 0.98
R4277:Cdhr3 UTSW 12 33060233 missense probably null 0.16
R4573:Cdhr3 UTSW 12 33068153 splice site probably null
R4752:Cdhr3 UTSW 12 33086103 missense probably damaging 0.99
R5364:Cdhr3 UTSW 12 33051008 missense possibly damaging 0.67
R5562:Cdhr3 UTSW 12 33051055 missense probably benign 0.01
R5564:Cdhr3 UTSW 12 33048986 nonsense probably null
R5768:Cdhr3 UTSW 12 33046686 missense possibly damaging 0.73
R6821:Cdhr3 UTSW 12 33035045 missense probably damaging 1.00
R6983:Cdhr3 UTSW 12 33042380 missense probably benign 0.32
R7155:Cdhr3 UTSW 12 33061773 missense probably damaging 1.00
R7496:Cdhr3 UTSW 12 33060265 missense probably damaging 1.00
R7736:Cdhr3 UTSW 12 33053520 missense probably benign 0.33
R7788:Cdhr3 UTSW 12 33060320 missense probably damaging 1.00
R8178:Cdhr3 UTSW 12 33048932 splice site probably null
R9226:Cdhr3 UTSW 12 33082321 missense probably damaging 0.99
RF023:Cdhr3 UTSW 12 33060349 missense probably damaging 1.00
X0024:Cdhr3 UTSW 12 33067236 missense possibly damaging 0.90
X0028:Cdhr3 UTSW 12 33042456 missense probably benign
Z1176:Cdhr3 UTSW 12 33060322 missense probably damaging 1.00
Z1176:Cdhr3 UTSW 12 33080324 missense probably benign 0.23
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2018-02-28