Incidental Mutation 'R6255:Panx2'
ID 506074
Institutional Source Beutler Lab
Gene Symbol Panx2
Ensembl Gene ENSMUSG00000058441
Gene Name pannexin 2
MMRRC Submission 044372-MU
Accession Numbers

Genbank: NM_001002005; MGI: 1890615

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6255 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 89059734-89073567 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 89067618 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 96 (R96H)
Ref Sequence ENSEMBL: ENSMUSP00000124354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161372] [ENSMUST00000162424]
AlphaFold Q6IMP4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159412
Predicted Effect probably benign
Transcript: ENSMUST00000159960
Predicted Effect probably damaging
Transcript: ENSMUST00000161372
AA Change: R104H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125514
Gene: ENSMUSG00000058441
AA Change: R104H

Pfam:Innexin 48 274 2.1e-11 PFAM
transmembrane domain 302 324 N/A INTRINSIC
low complexity region 429 438 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 601 617 N/A INTRINSIC
low complexity region 630 648 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161735
Predicted Effect probably damaging
Transcript: ENSMUST00000162424
AA Change: R96H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124354
Gene: ENSMUSG00000058441
AA Change: R96H

low complexity region 34 48 N/A INTRINSIC
Pfam:Innexin 49 263 5.6e-18 PFAM
transmembrane domain 294 316 N/A INTRINSIC
low complexity region 421 430 N/A INTRINSIC
low complexity region 490 505 N/A INTRINSIC
low complexity region 593 609 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162579
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the innexin family. Innexin family members are the structural components of gap junctions. This protein and pannexin 1 are abundantly expressed in central nervous system (CNS) and are coexpressed in various neuronal populations. Studies in Xenopus oocytes suggest that this protein alone and in combination with pannexin 1 may form cell type-specific gap junctions with distinct properties. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a slight protection from the neurological defects induced by ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,123 V7E possibly damaging Het
Aars2 G A 17: 45,514,609 G333S probably damaging Het
Aen T A 7: 78,905,844 I85N probably damaging Het
Ahnak C A 19: 9,008,025 H2224Q possibly damaging Het
Aldh18a1 C T 19: 40,580,043 R41H possibly damaging Het
Bpifb9b T A 2: 154,309,364 W2R probably damaging Het
Caprin2 A G 6: 148,877,892 I139T probably benign Het
Cdhr3 T A 12: 33,053,475 N381I probably damaging Het
Cecr2 A G 6: 120,758,050 Y721C probably damaging Het
Cherp G T 8: 72,470,881 A125D probably damaging Het
Cped1 G A 6: 22,138,715 probably null Het
Ctdp1 T A 18: 80,459,297 probably null Het
Cyp2c55 T C 19: 39,018,667 I169T probably benign Het
Cyp4a31 T C 4: 115,574,920 L418P possibly damaging Het
Efcab7 T C 4: 99,829,390 probably benign Het
Efcab8 T C 2: 153,810,268 W466R possibly damaging Het
Ehd3 C A 17: 73,805,413 N57K probably benign Het
Ern2 C A 7: 122,173,272 K654N probably damaging Het
Fbxo18 A T 2: 11,748,446 F879L probably benign Het
Gde1 T C 7: 118,691,781 D92G probably null Het
Gm4788 A T 1: 139,753,011 C256* probably null Het
Heatr5b A G 17: 78,803,434 V995A probably damaging Het
Ifrd2 A G 9: 107,592,091 E346G probably damaging Het
Ism1 AACGGACCCGTTCTTGTGGCTATGCA AA 2: 139,746,042 probably benign Het
Itgb4 T C 11: 115,998,137 V1102A possibly damaging Het
Itgb6 A T 2: 60,605,276 I710N probably damaging Het
Kif1a T C 1: 93,019,983 K1578E probably damaging Het
Kif9 T C 9: 110,517,834 probably null Het
Kitl T C 10: 100,089,233 *57Q probably null Het
Lrat C A 3: 82,903,505 V70F probably damaging Het
Lrrc9 T A 12: 72,487,023 M1022K probably benign Het
Muc16 T C 9: 18,655,599 T1875A unknown Het
Mup4 T A 4: 59,957,890 N171I probably damaging Het
Npas4 G A 19: 4,986,375 T587I probably damaging Het
Oas3 A G 5: 120,771,230 V217A probably benign Het
Olfr786 A G 10: 129,437,688 N292S possibly damaging Het
Osbp C A 19: 11,977,953 A323D possibly damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Piezo2 T C 18: 63,121,270 R385G possibly damaging Het
Pkn2 T C 3: 142,811,599 T476A probably damaging Het
Plekha4 T C 7: 45,553,802 probably benign Het
Ppfibp2 T C 7: 107,681,762 S94P probably damaging Het
Pramel7 T A 2: 87,489,663 I429L probably benign Het
Rif1 A G 2: 52,085,053 K325E probably damaging Het
Ror2 T C 13: 53,110,542 Y826C probably damaging Het
Rsph10b G A 5: 143,959,746 G19R probably damaging Het
Slc20a1 A G 2: 129,208,004 N361D probably damaging Het
Slc26a9 A G 1: 131,763,909 D630G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Trank1 T C 9: 111,352,246 probably null Het
Tspan10 T A 11: 120,444,542 C159* probably null Het
Uba6 G A 5: 86,164,765 T23I probably benign Het
Vmn2r74 T C 7: 85,952,451 T660A possibly damaging Het
Vwa5b1 T C 4: 138,578,672 N905S probably benign Het
Zfp831 T C 2: 174,646,421 L963P possibly damaging Het
Zfp990 T A 4: 145,537,789 N452K probably benign Het
Other mutations in Panx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01951:Panx2 APN 15 89068767 missense probably damaging 0.99
IGL02112:Panx2 APN 15 89069569 missense probably benign
IGL03384:Panx2 APN 15 89068119 missense possibly damaging 0.85
F6893:Panx2 UTSW 15 89068010 missense probably damaging 1.00
R0453:Panx2 UTSW 15 89068407 missense probably damaging 1.00
R1990:Panx2 UTSW 15 89069738 missense possibly damaging 0.95
R2912:Panx2 UTSW 15 89069821 missense probably benign 0.01
R3826:Panx2 UTSW 15 89068461 missense probably damaging 1.00
R4424:Panx2 UTSW 15 89068220 missense probably benign 0.02
R4593:Panx2 UTSW 15 89067915 missense probably damaging 1.00
R5176:Panx2 UTSW 15 89060228 missense probably damaging 1.00
R5328:Panx2 UTSW 15 89068095 missense probably damaging 0.99
R5333:Panx2 UTSW 15 89068539 missense possibly damaging 0.58
R5381:Panx2 UTSW 15 89060230 missense probably damaging 1.00
R5412:Panx2 UTSW 15 89068932 missense possibly damaging 0.79
R5450:Panx2 UTSW 15 89068959 missense possibly damaging 0.74
R5989:Panx2 UTSW 15 89060252 missense probably damaging 1.00
R7585:Panx2 UTSW 15 89067966 missense probably damaging 1.00
R7685:Panx2 UTSW 15 89067770 missense possibly damaging 0.65
R7899:Panx2 UTSW 15 89068733 missense possibly damaging 0.74
R8030:Panx2 UTSW 15 89068079 missense probably damaging 1.00
R9458:Panx2 UTSW 15 89067854 missense possibly damaging 0.93
R9458:Panx2 UTSW 15 89067855 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2018-02-28