Incidental Mutation 'R6255:Aars2'
ID 506075
Institutional Source Beutler Lab
Gene Symbol Aars2
Ensembl Gene ENSMUSG00000023938
Gene Name alanyl-tRNA synthetase 2, mitochondrial
Synonyms Aarsl
MMRRC Submission 044372-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6255 (G1)
Quality Score 172.009
Status Validated
Chromosome 17
Chromosomal Location 45506841-45520842 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 45514609 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 333 (G333S)
Ref Sequence ENSEMBL: ENSMUSP00000024733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024733]
AlphaFold Q14CH7
Predicted Effect probably damaging
Transcript: ENSMUST00000024733
AA Change: G333S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024733
Gene: ENSMUSG00000023938
AA Change: G333S

low complexity region 2 15 N/A INTRINSIC
Pfam:tRNA-synt_2c 36 619 4e-175 PFAM
low complexity region 663 674 N/A INTRINSIC
tRNA_SAD 716 774 2.65e-10 SMART
coiled coil region 833 863 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class-II aminoacyl-tRNA synthetase family. Aminoacyl-tRNA synthetases play critical roles in mRNA translation by charging tRNAs with their cognate amino acids. The encoded protein is a mitochondrial enzyme that specifically aminoacylates alanyl-tRNA. Mutations in this gene are a cause of combined oxidative phosphorylation deficiency 8. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,123 V7E possibly damaging Het
Aen T A 7: 78,905,844 I85N probably damaging Het
Ahnak C A 19: 9,008,025 H2224Q possibly damaging Het
Aldh18a1 C T 19: 40,580,043 R41H possibly damaging Het
Bpifb9b T A 2: 154,309,364 W2R probably damaging Het
Caprin2 A G 6: 148,877,892 I139T probably benign Het
Cdhr3 T A 12: 33,053,475 N381I probably damaging Het
Cecr2 A G 6: 120,758,050 Y721C probably damaging Het
Cherp G T 8: 72,470,881 A125D probably damaging Het
Cped1 G A 6: 22,138,715 probably null Het
Ctdp1 T A 18: 80,459,297 probably null Het
Cyp2c55 T C 19: 39,018,667 I169T probably benign Het
Cyp4a31 T C 4: 115,574,920 L418P possibly damaging Het
Efcab7 T C 4: 99,829,390 probably benign Het
Efcab8 T C 2: 153,810,268 W466R possibly damaging Het
Ehd3 C A 17: 73,805,413 N57K probably benign Het
Ern2 C A 7: 122,173,272 K654N probably damaging Het
Fbxo18 A T 2: 11,748,446 F879L probably benign Het
Gde1 T C 7: 118,691,781 D92G probably null Het
Gm4788 A T 1: 139,753,011 C256* probably null Het
Heatr5b A G 17: 78,803,434 V995A probably damaging Het
Ifrd2 A G 9: 107,592,091 E346G probably damaging Het
Ism1 AACGGACCCGTTCTTGTGGCTATGCA AA 2: 139,746,042 probably benign Het
Itgb4 T C 11: 115,998,137 V1102A possibly damaging Het
Itgb6 A T 2: 60,605,276 I710N probably damaging Het
Kif1a T C 1: 93,019,983 K1578E probably damaging Het
Kif9 T C 9: 110,517,834 probably null Het
Kitl T C 10: 100,089,233 *57Q probably null Het
Lrat C A 3: 82,903,505 V70F probably damaging Het
Lrrc9 T A 12: 72,487,023 M1022K probably benign Het
Muc16 T C 9: 18,655,599 T1875A unknown Het
Mup4 T A 4: 59,957,890 N171I probably damaging Het
Npas4 G A 19: 4,986,375 T587I probably damaging Het
Oas3 A G 5: 120,771,230 V217A probably benign Het
Olfr786 A G 10: 129,437,688 N292S possibly damaging Het
Osbp C A 19: 11,977,953 A323D possibly damaging Het
Panx2 G A 15: 89,067,618 R96H probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Piezo2 T C 18: 63,121,270 R385G possibly damaging Het
Pkn2 T C 3: 142,811,599 T476A probably damaging Het
Plekha4 T C 7: 45,553,802 probably benign Het
Ppfibp2 T C 7: 107,681,762 S94P probably damaging Het
Pramel7 T A 2: 87,489,663 I429L probably benign Het
Rif1 A G 2: 52,085,053 K325E probably damaging Het
Ror2 T C 13: 53,110,542 Y826C probably damaging Het
Rsph10b G A 5: 143,959,746 G19R probably damaging Het
Slc20a1 A G 2: 129,208,004 N361D probably damaging Het
Slc26a9 A G 1: 131,763,909 D630G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Trank1 T C 9: 111,352,246 probably null Het
Tspan10 T A 11: 120,444,542 C159* probably null Het
Uba6 G A 5: 86,164,765 T23I probably benign Het
Vmn2r74 T C 7: 85,952,451 T660A possibly damaging Het
Vwa5b1 T C 4: 138,578,672 N905S probably benign Het
Zfp831 T C 2: 174,646,421 L963P possibly damaging Het
Zfp990 T A 4: 145,537,789 N452K probably benign Het
Other mutations in Aars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02958:Aars2 APN 17 45518172 missense probably benign 0.00
dread_pirate UTSW 17 45516564 missense probably damaging 1.00
R0266:Aars2 UTSW 17 45507510 splice site probably benign
R0315:Aars2 UTSW 17 45515452 missense possibly damaging 0.67
R0375:Aars2 UTSW 17 45514550 missense probably damaging 0.99
R0629:Aars2 UTSW 17 45507547 missense probably damaging 0.99
R0981:Aars2 UTSW 17 45520331 missense probably damaging 1.00
R1878:Aars2 UTSW 17 45514638 critical splice donor site probably null
R1893:Aars2 UTSW 17 45514799 missense probably benign 0.14
R2035:Aars2 UTSW 17 45514801 missense possibly damaging 0.87
R2099:Aars2 UTSW 17 45506894 missense unknown
R4342:Aars2 UTSW 17 45516495 missense probably benign
R4600:Aars2 UTSW 17 45516921 missense probably damaging 1.00
R4601:Aars2 UTSW 17 45516921 missense probably damaging 1.00
R4610:Aars2 UTSW 17 45516921 missense probably damaging 1.00
R5158:Aars2 UTSW 17 45514829 missense probably benign 0.07
R5943:Aars2 UTSW 17 45517711 missense probably benign 0.30
R5992:Aars2 UTSW 17 45508623 nonsense probably null
R6381:Aars2 UTSW 17 45518545 missense probably benign 0.04
R6392:Aars2 UTSW 17 45514600 missense probably damaging 0.98
R6406:Aars2 UTSW 17 45506939 missense probably benign 0.16
R6648:Aars2 UTSW 17 45516564 missense probably damaging 1.00
R7135:Aars2 UTSW 17 45508961 nonsense probably null
R7197:Aars2 UTSW 17 45508959 missense probably damaging 1.00
R7203:Aars2 UTSW 17 45516571 missense probably damaging 1.00
R7289:Aars2 UTSW 17 45507624 missense probably damaging 0.99
R7669:Aars2 UTSW 17 45520295 missense probably benign 0.06
R8303:Aars2 UTSW 17 45507597 missense probably damaging 1.00
R8772:Aars2 UTSW 17 45516977 missense probably benign 0.19
R8795:Aars2 UTSW 17 45507672 missense probably damaging 0.99
R9069:Aars2 UTSW 17 45507597 missense probably damaging 1.00
R9206:Aars2 UTSW 17 45509404 missense probably benign 0.03
R9342:Aars2 UTSW 17 45507076 missense possibly damaging 0.94
R9467:Aars2 UTSW 17 45516484 missense probably benign 0.01
R9730:Aars2 UTSW 17 45518608 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2018-02-28