Incidental Mutation 'R6255:Ctdp1'
ID 506080
Institutional Source Beutler Lab
Gene Symbol Ctdp1
Ensembl Gene ENSMUSG00000033323
Gene Name CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1
Synonyms 4930563P03Rik
MMRRC Submission 044372-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock # R6255 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 80407959-80469695 bp(-) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to A at 80459297 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036229] [ENSMUST00000036229] [ENSMUST00000036229]
AlphaFold Q7TSG2
Predicted Effect probably null
Transcript: ENSMUST00000036229
SMART Domains Protein: ENSMUSP00000038938
Gene: ENSMUSG00000033323

DomainStartEndE-ValueType
low complexity region 55 72 N/A INTRINSIC
CPDc 181 327 1.21e-62 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 568 587 N/A INTRINSIC
BRCT 621 708 9.62e-7 SMART
low complexity region 779 787 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
PDB:1ONV|B 890 921 2e-6 PDB
coiled coil region 936 959 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000036229
SMART Domains Protein: ENSMUSP00000038938
Gene: ENSMUSG00000033323

DomainStartEndE-ValueType
low complexity region 55 72 N/A INTRINSIC
CPDc 181 327 1.21e-62 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 568 587 N/A INTRINSIC
BRCT 621 708 9.62e-7 SMART
low complexity region 779 787 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
PDB:1ONV|B 890 921 2e-6 PDB
coiled coil region 936 959 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000036229
SMART Domains Protein: ENSMUSP00000038938
Gene: ENSMUSG00000033323

DomainStartEndE-ValueType
low complexity region 55 72 N/A INTRINSIC
CPDc 181 327 1.21e-62 SMART
low complexity region 458 471 N/A INTRINSIC
low complexity region 568 587 N/A INTRINSIC
BRCT 621 708 9.62e-7 SMART
low complexity region 779 787 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
PDB:1ONV|B 890 921 2e-6 PDB
coiled coil region 936 959 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with the carboxy-terminus of the RAP74 subunit of transcription initiation factor TFIIF, and functions as a phosphatase that processively dephosphorylates the C-terminus of POLR2A (a subunit of RNA polymerase II), making it available for initiation of gene expression. Mutations in this gene are associated with congenital cataracts, facial dysmorphism and neuropathy syndrome (CCFDN). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,123 V7E possibly damaging Het
Aars2 G A 17: 45,514,609 G333S probably damaging Het
Aen T A 7: 78,905,844 I85N probably damaging Het
Ahnak C A 19: 9,008,025 H2224Q possibly damaging Het
Aldh18a1 C T 19: 40,580,043 R41H possibly damaging Het
Bpifb9b T A 2: 154,309,364 W2R probably damaging Het
Caprin2 A G 6: 148,877,892 I139T probably benign Het
Cdhr3 T A 12: 33,053,475 N381I probably damaging Het
Cecr2 A G 6: 120,758,050 Y721C probably damaging Het
Cherp G T 8: 72,470,881 A125D probably damaging Het
Cped1 G A 6: 22,138,715 probably null Het
Cyp2c55 T C 19: 39,018,667 I169T probably benign Het
Cyp4a31 T C 4: 115,574,920 L418P possibly damaging Het
Efcab7 T C 4: 99,829,390 probably benign Het
Efcab8 T C 2: 153,810,268 W466R possibly damaging Het
Ehd3 C A 17: 73,805,413 N57K probably benign Het
Ern2 C A 7: 122,173,272 K654N probably damaging Het
Fbxo18 A T 2: 11,748,446 F879L probably benign Het
Gde1 T C 7: 118,691,781 D92G probably null Het
Gm4788 A T 1: 139,753,011 C256* probably null Het
Heatr5b A G 17: 78,803,434 V995A probably damaging Het
Ifrd2 A G 9: 107,592,091 E346G probably damaging Het
Ism1 AACGGACCCGTTCTTGTGGCTATGCA AA 2: 139,746,042 probably benign Het
Itgb4 T C 11: 115,998,137 V1102A possibly damaging Het
Itgb6 A T 2: 60,605,276 I710N probably damaging Het
Kif1a T C 1: 93,019,983 K1578E probably damaging Het
Kif9 T C 9: 110,517,834 probably null Het
Kitl T C 10: 100,089,233 *57Q probably null Het
Lrat C A 3: 82,903,505 V70F probably damaging Het
Lrrc9 T A 12: 72,487,023 M1022K probably benign Het
Muc16 T C 9: 18,655,599 T1875A unknown Het
Mup4 T A 4: 59,957,890 N171I probably damaging Het
Npas4 G A 19: 4,986,375 T587I probably damaging Het
Oas3 A G 5: 120,771,230 V217A probably benign Het
Olfr786 A G 10: 129,437,688 N292S possibly damaging Het
Osbp C A 19: 11,977,953 A323D possibly damaging Het
Panx2 G A 15: 89,067,618 R96H probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Piezo2 T C 18: 63,121,270 R385G possibly damaging Het
Pkn2 T C 3: 142,811,599 T476A probably damaging Het
Plekha4 T C 7: 45,553,802 probably benign Het
Ppfibp2 T C 7: 107,681,762 S94P probably damaging Het
Pramel7 T A 2: 87,489,663 I429L probably benign Het
Rif1 A G 2: 52,085,053 K325E probably damaging Het
Ror2 T C 13: 53,110,542 Y826C probably damaging Het
Rsph10b G A 5: 143,959,746 G19R probably damaging Het
Slc20a1 A G 2: 129,208,004 N361D probably damaging Het
Slc26a9 A G 1: 131,763,909 D630G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Trank1 T C 9: 111,352,246 probably null Het
Tspan10 T A 11: 120,444,542 C159* probably null Het
Uba6 G A 5: 86,164,765 T23I probably benign Het
Vmn2r74 T C 7: 85,952,451 T660A possibly damaging Het
Vwa5b1 T C 4: 138,578,672 N905S probably benign Het
Zfp831 T C 2: 174,646,421 L963P possibly damaging Het
Zfp990 T A 4: 145,537,789 N452K probably benign Het
Other mutations in Ctdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Ctdp1 APN 18 80458692 splice site probably null
IGL01695:Ctdp1 APN 18 80449626 missense probably damaging 1.00
IGL01865:Ctdp1 APN 18 80455984 missense probably damaging 1.00
IGL02009:Ctdp1 APN 18 80455972 missense probably damaging 1.00
IGL02419:Ctdp1 APN 18 80420584 missense probably damaging 1.00
IGL02580:Ctdp1 APN 18 80450090 missense probably benign 0.01
IGL02699:Ctdp1 APN 18 80450185 missense probably benign
IGL03117:Ctdp1 APN 18 80449501 missense probably damaging 0.98
IGL03301:Ctdp1 APN 18 80449634 nonsense probably null
IGL03385:Ctdp1 APN 18 80449918 missense probably damaging 1.00
R0370:Ctdp1 UTSW 18 80449354 missense probably damaging 1.00
R0374:Ctdp1 UTSW 18 80447422 critical splice donor site probably null
R0730:Ctdp1 UTSW 18 80450242 missense probably benign 0.00
R0894:Ctdp1 UTSW 18 80469521 missense probably benign 0.09
R1187:Ctdp1 UTSW 18 80449487 missense probably damaging 1.00
R1437:Ctdp1 UTSW 18 80450213 missense probably benign 0.01
R1988:Ctdp1 UTSW 18 80449401 missense possibly damaging 0.89
R2192:Ctdp1 UTSW 18 80449481 missense probably benign 0.30
R3709:Ctdp1 UTSW 18 80450213 nonsense probably null
R3724:Ctdp1 UTSW 18 80459267 missense probably benign 0.16
R3756:Ctdp1 UTSW 18 80452351 missense probably damaging 0.98
R4297:Ctdp1 UTSW 18 80449957 missense probably benign
R4298:Ctdp1 UTSW 18 80449957 missense probably benign
R4640:Ctdp1 UTSW 18 80451154 critical splice donor site probably null
R4841:Ctdp1 UTSW 18 80408726 missense unknown
R4842:Ctdp1 UTSW 18 80408726 missense unknown
R5007:Ctdp1 UTSW 18 80420480 missense probably damaging 0.99
R5055:Ctdp1 UTSW 18 80456088 missense probably damaging 1.00
R5219:Ctdp1 UTSW 18 80447460 missense probably damaging 1.00
R5870:Ctdp1 UTSW 18 80408686 missense unknown
R5896:Ctdp1 UTSW 18 80458788 missense probably damaging 1.00
R6242:Ctdp1 UTSW 18 80459212 missense probably damaging 1.00
R6300:Ctdp1 UTSW 18 80459240 missense probably benign 0.26
R6431:Ctdp1 UTSW 18 80451255 missense probably damaging 0.96
R6462:Ctdp1 UTSW 18 80420474 missense probably damaging 0.98
R6512:Ctdp1 UTSW 18 80451263 missense probably damaging 1.00
R6537:Ctdp1 UTSW 18 80449551 missense probably benign
R6802:Ctdp1 UTSW 18 80420441 critical splice donor site probably null
R7477:Ctdp1 UTSW 18 80440714 splice site probably null
R8121:Ctdp1 UTSW 18 80456008 missense probably damaging 1.00
R8348:Ctdp1 UTSW 18 80450110 missense probably benign 0.00
R8350:Ctdp1 UTSW 18 80469279 missense probably benign 0.03
R8513:Ctdp1 UTSW 18 80449463 missense possibly damaging 0.49
R9140:Ctdp1 UTSW 18 80440828 critical splice donor site probably null
R9339:Ctdp1 UTSW 18 80449474 missense probably damaging 1.00
X0020:Ctdp1 UTSW 18 80449990 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGCTACATCTTAGGAAGCAGTC -3'
(R):5'- CTTGTGCTGACTAGTGACTGC -3'

Sequencing Primer
(F):5'- CAGTATTCAGATGGGGCTGCCTATC -3'
(R):5'- GGTATGACCTAGAGCCCAGTTTC -3'
Posted On 2018-02-28