Mutagenetix > Incidental Mutation

Incidental Mutation 'R6255:Ctdp1'

506080

Institutional Source

Beutler Lab

Gene Symbol

Ctdp1

Ensembl Gene

ENSMUSG00000033323

Gene Name

CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1

Synonyms

4930563P03Rik

MMRRC Submission

044372-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.924) question?

Stock #

R6255 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80407959-80469695 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to A at 80459297 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000038938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036229] [ENSMUST00000036229] [ENSMUST00000036229]

AlphaFold

Q7TSG2

Predicted Effect

probably null
Transcript: ENSMUST00000036229

SMART Domains

Protein: ENSMUSP00000038938
Gene: ENSMUSG00000033323

Domain	Start	End	E-Value	Type
low complexity region	55	72	N/A	INTRINSIC
CPDc	181	327	1.21e-62	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	568	587	N/A	INTRINSIC
BRCT	621	708	9.62e-7	SMART
low complexity region	779	787	N/A	INTRINSIC
low complexity region	879	889	N/A	INTRINSIC
PDB:1ONV\|B	890	921	2e-6	PDB
coiled coil region	936	959	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000036229

SMART Domains

Protein: ENSMUSP00000038938
Gene: ENSMUSG00000033323

Domain	Start	End	E-Value	Type
low complexity region	55	72	N/A	INTRINSIC
CPDc	181	327	1.21e-62	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	568	587	N/A	INTRINSIC
BRCT	621	708	9.62e-7	SMART
low complexity region	779	787	N/A	INTRINSIC
low complexity region	879	889	N/A	INTRINSIC
PDB:1ONV\|B	890	921	2e-6	PDB
coiled coil region	936	959	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000036229

SMART Domains

Protein: ENSMUSP00000038938
Gene: ENSMUSG00000033323

Domain	Start	End	E-Value	Type
low complexity region	55	72	N/A	INTRINSIC
CPDc	181	327	1.21e-62	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	568	587	N/A	INTRINSIC
BRCT	621	708	9.62e-7	SMART
low complexity region	779	787	N/A	INTRINSIC
low complexity region	879	889	N/A	INTRINSIC
PDB:1ONV\|B	890	921	2e-6	PDB
coiled coil region	936	959	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with the carboxy-terminus of the RAP74 subunit of transcription initiation factor TFIIF, and functions as a phosphatase that processively dephosphorylates the C-terminus of POLR2A (a subunit of RNA polymerase II), making it available for initiation of gene expression. Mutations in this gene are associated with congenital cataracts, facial dysmorphism and neuropathy syndrome (CCFDN). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	T	A	13: 119,466,123	V7E	possibly damaging	Het
Aars2	G	A	17: 45,514,609	G333S	probably damaging	Het
Aen	T	A	7: 78,905,844	I85N	probably damaging	Het
Ahnak	C	A	19: 9,008,025	H2224Q	possibly damaging	Het
Aldh18a1	C	T	19: 40,580,043	R41H	possibly damaging	Het
Bpifb9b	T	A	2: 154,309,364	W2R	probably damaging	Het
Caprin2	A	G	6: 148,877,892	I139T	probably benign	Het
Cdhr3	T	A	12: 33,053,475	N381I	probably damaging	Het
Cecr2	A	G	6: 120,758,050	Y721C	probably damaging	Het
Cherp	G	T	8: 72,470,881	A125D	probably damaging	Het
Cped1	G	A	6: 22,138,715		probably null	Het
Cyp2c55	T	C	19: 39,018,667	I169T	probably benign	Het
Cyp4a31	T	C	4: 115,574,920	L418P	possibly damaging	Het
Efcab7	T	C	4: 99,829,390		probably benign	Het
Efcab8	T	C	2: 153,810,268	W466R	possibly damaging	Het
Ehd3	C	A	17: 73,805,413	N57K	probably benign	Het
Ern2	C	A	7: 122,173,272	K654N	probably damaging	Het
Fbxo18	A	T	2: 11,748,446	F879L	probably benign	Het
Gde1	T	C	7: 118,691,781	D92G	probably null	Het
Gm4788	A	T	1: 139,753,011	C256*	probably null	Het
Heatr5b	A	G	17: 78,803,434	V995A	probably damaging	Het
Ifrd2	A	G	9: 107,592,091	E346G	probably damaging	Het
Ism1	AACGGACCCGTTCTTGTGGCTATGCA	AA	2: 139,746,042		probably benign	Het
Itgb4	T	C	11: 115,998,137	V1102A	possibly damaging	Het
Itgb6	A	T	2: 60,605,276	I710N	probably damaging	Het
Kif1a	T	C	1: 93,019,983	K1578E	probably damaging	Het
Kif9	T	C	9: 110,517,834		probably null	Het
Kitl	T	C	10: 100,089,233	*57Q	probably null	Het
Lrat	C	A	3: 82,903,505	V70F	probably damaging	Het
Lrrc9	T	A	12: 72,487,023	M1022K	probably benign	Het
Muc16	T	C	9: 18,655,599	T1875A	unknown	Het
Mup4	T	A	4: 59,957,890	N171I	probably damaging	Het
Npas4	G	A	19: 4,986,375	T587I	probably damaging	Het
Oas3	A	G	5: 120,771,230	V217A	probably benign	Het
Olfr786	A	G	10: 129,437,688	N292S	possibly damaging	Het
Osbp	C	A	19: 11,977,953	A323D	possibly damaging	Het
Panx2	G	A	15: 89,067,618	R96H	probably damaging	Het
Pcdhb18	G	A	18: 37,490,484	R289Q	probably benign	Het
Piezo2	T	C	18: 63,121,270	R385G	possibly damaging	Het
Pkn2	T	C	3: 142,811,599	T476A	probably damaging	Het
Plekha4	T	C	7: 45,553,802		probably benign	Het
Ppfibp2	T	C	7: 107,681,762	S94P	probably damaging	Het
Pramel7	T	A	2: 87,489,663	I429L	probably benign	Het
Rif1	A	G	2: 52,085,053	K325E	probably damaging	Het
Ror2	T	C	13: 53,110,542	Y826C	probably damaging	Het
Rsph10b	G	A	5: 143,959,746	G19R	probably damaging	Het
Slc20a1	A	G	2: 129,208,004	N361D	probably damaging	Het
Slc26a9	A	G	1: 131,763,909	D630G	probably benign	Het
Smtnl2	G	A	11: 72,401,399	A274V	probably damaging	Het
Trank1	T	C	9: 111,352,246		probably null	Het
Tspan10	T	A	11: 120,444,542	C159*	probably null	Het
Uba6	G	A	5: 86,164,765	T23I	probably benign	Het
Vmn2r74	T	C	7: 85,952,451	T660A	possibly damaging	Het
Vwa5b1	T	C	4: 138,578,672	N905S	probably benign	Het
Zfp831	T	C	2: 174,646,421	L963P	possibly damaging	Het
Zfp990	T	A	4: 145,537,789	N452K	probably benign	Het

Other mutations in Ctdp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00787:Ctdp1	APN	18	80458692	splice site	probably null
IGL01695:Ctdp1	APN	18	80449626	missense	probably damaging	1.00
IGL01865:Ctdp1	APN	18	80455984	missense	probably damaging	1.00
IGL02009:Ctdp1	APN	18	80455972	missense	probably damaging	1.00
IGL02419:Ctdp1	APN	18	80420584	missense	probably damaging	1.00
IGL02580:Ctdp1	APN	18	80450090	missense	probably benign	0.01
IGL02699:Ctdp1	APN	18	80450185	missense	probably benign
IGL03117:Ctdp1	APN	18	80449501	missense	probably damaging	0.98
IGL03301:Ctdp1	APN	18	80449634	nonsense	probably null
IGL03385:Ctdp1	APN	18	80449918	missense	probably damaging	1.00
R0370:Ctdp1	UTSW	18	80449354	missense	probably damaging	1.00
R0374:Ctdp1	UTSW	18	80447422	critical splice donor site	probably null
R0730:Ctdp1	UTSW	18	80450242	missense	probably benign	0.00
R0894:Ctdp1	UTSW	18	80469521	missense	probably benign	0.09
R1187:Ctdp1	UTSW	18	80449487	missense	probably damaging	1.00
R1437:Ctdp1	UTSW	18	80450213	missense	probably benign	0.01
R1988:Ctdp1	UTSW	18	80449401	missense	possibly damaging	0.89
R2192:Ctdp1	UTSW	18	80449481	missense	probably benign	0.30
R3709:Ctdp1	UTSW	18	80450213	nonsense	probably null
R3724:Ctdp1	UTSW	18	80459267	missense	probably benign	0.16
R3756:Ctdp1	UTSW	18	80452351	missense	probably damaging	0.98
R4297:Ctdp1	UTSW	18	80449957	missense	probably benign
R4298:Ctdp1	UTSW	18	80449957	missense	probably benign
R4640:Ctdp1	UTSW	18	80451154	critical splice donor site	probably null
R4841:Ctdp1	UTSW	18	80408726	missense	unknown
R4842:Ctdp1	UTSW	18	80408726	missense	unknown
R5007:Ctdp1	UTSW	18	80420480	missense	probably damaging	0.99
R5055:Ctdp1	UTSW	18	80456088	missense	probably damaging	1.00
R5219:Ctdp1	UTSW	18	80447460	missense	probably damaging	1.00
R5870:Ctdp1	UTSW	18	80408686	missense	unknown
R5896:Ctdp1	UTSW	18	80458788	missense	probably damaging	1.00
R6242:Ctdp1	UTSW	18	80459212	missense	probably damaging	1.00
R6300:Ctdp1	UTSW	18	80459240	missense	probably benign	0.26
R6431:Ctdp1	UTSW	18	80451255	missense	probably damaging	0.96
R6462:Ctdp1	UTSW	18	80420474	missense	probably damaging	0.98
R6512:Ctdp1	UTSW	18	80451263	missense	probably damaging	1.00
R6537:Ctdp1	UTSW	18	80449551	missense	probably benign
R6802:Ctdp1	UTSW	18	80420441	critical splice donor site	probably null
R7477:Ctdp1	UTSW	18	80440714	splice site	probably null
R8121:Ctdp1	UTSW	18	80456008	missense	probably damaging	1.00
R8348:Ctdp1	UTSW	18	80450110	missense	probably benign	0.00
R8350:Ctdp1	UTSW	18	80469279	missense	probably benign	0.03
R8513:Ctdp1	UTSW	18	80449463	missense	possibly damaging	0.49
R9140:Ctdp1	UTSW	18	80440828	critical splice donor site	probably null
R9339:Ctdp1	UTSW	18	80449474	missense	probably damaging	1.00
R9617:Ctdp1	UTSW	18	80449747	missense	probably benign
R9758:Ctdp1	UTSW	18	80449495	missense	probably damaging	1.00
R9762:Ctdp1	UTSW	18	80449335	nonsense	probably null
X0020:Ctdp1	UTSW	18	80449990	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GAGCTACATCTTAGGAAGCAGTC -3'
(R):5'- CTTGTGCTGACTAGTGACTGC -3'

Sequencing Primer
(F):5'- CAGTATTCAGATGGGGCTGCCTATC -3'
(R):5'- GGTATGACCTAGAGCCCAGTTTC -3'

Posted On

2018-02-28