Incidental Mutation 'R6255:Ahnak'
ID 506082
Institutional Source Beutler Lab
Gene Symbol Ahnak
Ensembl Gene ENSMUSG00000069833
Gene Name AHNAK nucleoprotein (desmoyokin)
Synonyms 1110004P15Rik, 2310047C17Rik, DY6
MMRRC Submission 044372-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock # R6255 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 8989284-9076919 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 9008025 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 2224 (H2224Q)
Ref Sequence ENSEMBL: ENSMUSP00000090633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092955] [ENSMUST00000092956]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000092955
SMART Domains Protein: ENSMUSP00000090632
Gene: ENSMUSG00000069833

low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000092956
AA Change: H2224Q

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090633
Gene: ENSMUSG00000069833
AA Change: H2224Q

low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
internal_repeat_2 163 1515 5.22e-182 PROSPERO
internal_repeat_1 224 2314 N/A PROSPERO
internal_repeat_2 1532 3028 5.22e-182 PROSPERO
internal_repeat_1 2660 5095 N/A PROSPERO
low complexity region 5336 5353 N/A INTRINSIC
low complexity region 5493 5504 N/A INTRINSIC
low complexity region 5580 5600 N/A INTRINSIC
low complexity region 5620 5636 N/A INTRINSIC
Meta Mutation Damage Score 0.0868 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a large (700 kDa) structural scaffold protein consisting of a central domain with 128 aa repeats. The encoded protein may play a role in such diverse processes as blood-brain barrier formation, cell structure and migration, cardiac calcium channel regulation, and tumor metastasis. A much shorter variant encoding a 17 kDa isoform exists for this gene, and the shorter isoform initiates a feedback loop that regulates alternative splicing of this gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit decreased T cell proliferation and increased susceptibility to parasitic infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,123 V7E possibly damaging Het
Aars2 G A 17: 45,514,609 G333S probably damaging Het
Aen T A 7: 78,905,844 I85N probably damaging Het
Aldh18a1 C T 19: 40,580,043 R41H possibly damaging Het
Bpifb9b T A 2: 154,309,364 W2R probably damaging Het
Caprin2 A G 6: 148,877,892 I139T probably benign Het
Cdhr3 T A 12: 33,053,475 N381I probably damaging Het
Cecr2 A G 6: 120,758,050 Y721C probably damaging Het
Cherp G T 8: 72,470,881 A125D probably damaging Het
Cped1 G A 6: 22,138,715 probably null Het
Ctdp1 T A 18: 80,459,297 probably null Het
Cyp2c55 T C 19: 39,018,667 I169T probably benign Het
Cyp4a31 T C 4: 115,574,920 L418P possibly damaging Het
Efcab7 T C 4: 99,829,390 probably benign Het
Efcab8 T C 2: 153,810,268 W466R possibly damaging Het
Ehd3 C A 17: 73,805,413 N57K probably benign Het
Ern2 C A 7: 122,173,272 K654N probably damaging Het
Fbxo18 A T 2: 11,748,446 F879L probably benign Het
Gde1 T C 7: 118,691,781 D92G probably null Het
Gm4788 A T 1: 139,753,011 C256* probably null Het
Heatr5b A G 17: 78,803,434 V995A probably damaging Het
Ifrd2 A G 9: 107,592,091 E346G probably damaging Het
Ism1 AACGGACCCGTTCTTGTGGCTATGCA AA 2: 139,746,042 probably benign Het
Itgb4 T C 11: 115,998,137 V1102A possibly damaging Het
Itgb6 A T 2: 60,605,276 I710N probably damaging Het
Kif1a T C 1: 93,019,983 K1578E probably damaging Het
Kif9 T C 9: 110,517,834 probably null Het
Kitl T C 10: 100,089,233 *57Q probably null Het
Lrat C A 3: 82,903,505 V70F probably damaging Het
Lrrc9 T A 12: 72,487,023 M1022K probably benign Het
Muc16 T C 9: 18,655,599 T1875A unknown Het
Mup4 T A 4: 59,957,890 N171I probably damaging Het
Npas4 G A 19: 4,986,375 T587I probably damaging Het
Oas3 A G 5: 120,771,230 V217A probably benign Het
Olfr786 A G 10: 129,437,688 N292S possibly damaging Het
Osbp C A 19: 11,977,953 A323D possibly damaging Het
Panx2 G A 15: 89,067,618 R96H probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Piezo2 T C 18: 63,121,270 R385G possibly damaging Het
Pkn2 T C 3: 142,811,599 T476A probably damaging Het
Plekha4 T C 7: 45,553,802 probably benign Het
Ppfibp2 T C 7: 107,681,762 S94P probably damaging Het
Pramel7 T A 2: 87,489,663 I429L probably benign Het
Rif1 A G 2: 52,085,053 K325E probably damaging Het
Ror2 T C 13: 53,110,542 Y826C probably damaging Het
Rsph10b G A 5: 143,959,746 G19R probably damaging Het
Slc20a1 A G 2: 129,208,004 N361D probably damaging Het
Slc26a9 A G 1: 131,763,909 D630G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Trank1 T C 9: 111,352,246 probably null Het
Tspan10 T A 11: 120,444,542 C159* probably null Het
Uba6 G A 5: 86,164,765 T23I probably benign Het
Vmn2r74 T C 7: 85,952,451 T660A possibly damaging Het
Vwa5b1 T C 4: 138,578,672 N905S probably benign Het
Zfp831 T C 2: 174,646,421 L963P possibly damaging Het
Zfp990 T A 4: 145,537,789 N452K probably benign Het
Other mutations in Ahnak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Ahnak APN 19 9007223 missense probably damaging 0.99
IGL00509:Ahnak APN 19 9009951 missense possibly damaging 0.94
IGL00539:Ahnak APN 19 9007908 missense possibly damaging 0.50
IGL00558:Ahnak APN 19 9004307 missense possibly damaging 0.93
IGL00567:Ahnak APN 19 9013383 missense probably benign 0.24
IGL00706:Ahnak APN 19 9013730 nonsense probably null
IGL00807:Ahnak APN 19 9008522 missense possibly damaging 0.92
IGL00870:Ahnak APN 19 9013698 missense probably damaging 1.00
IGL01101:Ahnak APN 19 9012887 intron probably benign
IGL01118:Ahnak APN 19 9012578 missense probably damaging 1.00
IGL01288:Ahnak APN 19 9002494 missense possibly damaging 0.94
IGL01324:Ahnak APN 19 9003032 missense probably damaging 1.00
IGL01341:Ahnak APN 19 9011703 missense probably benign
IGL01541:Ahnak APN 19 9007879 missense possibly damaging 0.95
IGL01580:Ahnak APN 19 9002839 missense probably benign 0.02
IGL01595:Ahnak APN 19 9003501 nonsense probably null
IGL01746:Ahnak APN 19 9004912 missense possibly damaging 0.89
IGL01766:Ahnak APN 19 9000118 missense unknown
IGL01821:Ahnak APN 19 9012118 missense probably benign
IGL01913:Ahnak APN 19 9006064 nonsense probably null
IGL01934:Ahnak APN 19 9002657 missense probably damaging 1.00
IGL01940:Ahnak APN 19 9006557 missense probably benign 0.14
IGL01958:Ahnak APN 19 9014909 missense possibly damaging 0.59
IGL02145:Ahnak APN 19 9002855 missense probably benign 0.11
IGL02246:Ahnak APN 19 9008268 missense probably damaging 1.00
IGL02282:Ahnak APN 19 9005987 missense probably damaging 1.00
IGL02428:Ahnak APN 19 9014833 missense possibly damaging 0.83
IGL02442:Ahnak APN 19 9004016 missense probably damaging 1.00
IGL02474:Ahnak APN 19 9004933 missense probably benign 0.13
IGL02483:Ahnak APN 19 9003308 missense probably benign 0.01
IGL02616:Ahnak APN 19 9005627 missense probably benign 0.03
IGL02630:Ahnak APN 19 9012077 missense probably damaging 1.00
IGL02690:Ahnak APN 19 9012584 nonsense probably null
IGL02717:Ahnak APN 19 9002387 missense probably benign 0.00
IGL02721:Ahnak APN 19 9009707 missense probably benign 0.07
IGL02737:Ahnak APN 19 9004593 missense probably benign 0.17
IGL02850:Ahnak APN 19 9002596 missense probably benign 0.00
IGL03071:Ahnak APN 19 9011918 missense possibly damaging 0.63
IGL03072:Ahnak APN 19 9006508 missense probably benign 0.11
IGL03094:Ahnak APN 19 9003547 missense possibly damaging 0.64
IGL03140:Ahnak APN 19 9005212 intron probably benign
IGL03176:Ahnak APN 19 9008166 missense possibly damaging 0.56
IGL03176:Ahnak APN 19 9002449 missense probably damaging 1.00
IGL03189:Ahnak APN 19 9011239 missense possibly damaging 0.65
IGL03357:Ahnak APN 19 9009325 intron probably benign
IGL03371:Ahnak APN 19 9004228 missense possibly damaging 0.91
Eskimo UTSW 19 9009574 missense probably benign 0.31
Nanook UTSW 19 9003231 missense probably benign 0.42
Netsilik UTSW 19 9002321 missense probably benign 0.00
IGL03097:Ahnak UTSW 19 9002387 missense probably benign 0.00
PIT4403001:Ahnak UTSW 19 9006176 missense possibly damaging 0.87
R0054:Ahnak UTSW 19 9012056 missense probably damaging 1.00
R0094:Ahnak UTSW 19 9013893 missense probably benign 0.12
R0110:Ahnak UTSW 19 9018232 nonsense probably null
R0141:Ahnak UTSW 19 9006680 missense probably damaging 1.00
R0166:Ahnak UTSW 19 9005725 missense probably damaging 1.00
R0309:Ahnak UTSW 19 9002495 missense probably damaging 1.00
R0368:Ahnak UTSW 19 9008350 nonsense probably null
R0386:Ahnak UTSW 19 9011144 missense possibly damaging 0.94
R0401:Ahnak UTSW 19 9015116 missense probably benign 0.24
R0415:Ahnak UTSW 19 9012871 intron probably benign
R0463:Ahnak UTSW 19 9009407 intron probably benign
R0469:Ahnak UTSW 19 9018232 nonsense probably null
R0470:Ahnak UTSW 19 9008967 missense probably benign 0.29
R0487:Ahnak UTSW 19 9007151 missense probably benign 0.00
R0487:Ahnak UTSW 19 9014120 missense probably damaging 0.99
R0499:Ahnak UTSW 19 9000264 splice site probably benign
R0506:Ahnak UTSW 19 9009128 missense probably damaging 1.00
R0510:Ahnak UTSW 19 9018232 nonsense probably null
R0557:Ahnak UTSW 19 9001944 missense probably benign 0.10
R0570:Ahnak UTSW 19 9013698 missense probably damaging 1.00
R0610:Ahnak UTSW 19 9007878 missense probably benign 0.08
R0646:Ahnak UTSW 19 9013402 nonsense probably null
R0659:Ahnak UTSW 19 9015002 missense possibly damaging 0.60
R0791:Ahnak UTSW 19 9016734 missense probably benign 0.01
R0792:Ahnak UTSW 19 9016734 missense probably benign 0.01
R0840:Ahnak UTSW 19 9005063 missense probably damaging 1.00
R0847:Ahnak UTSW 19 9006433 nonsense probably null
R0941:Ahnak UTSW 19 9009914 missense probably damaging 1.00
R0962:Ahnak UTSW 19 9012848 intron probably benign
R1017:Ahnak UTSW 19 9010543 missense probably damaging 0.99
R1037:Ahnak UTSW 19 9007618 missense probably benign 0.27
R1085:Ahnak UTSW 19 9013125 missense possibly damaging 0.50
R1113:Ahnak UTSW 19 9005620 missense probably benign 0.29
R1140:Ahnak UTSW 19 9004245 missense probably damaging 1.00
R1158:Ahnak UTSW 19 9013926 missense probably benign 0.00
R1218:Ahnak UTSW 19 9015619 missense probably damaging 1.00
R1225:Ahnak UTSW 19 9002883 missense probably damaging 1.00
R1245:Ahnak UTSW 19 9004169 missense probably benign 0.44
R1421:Ahnak UTSW 19 9015631 missense possibly damaging 0.95
R1447:Ahnak UTSW 19 9007082 missense probably damaging 0.98
R1464:Ahnak UTSW 19 9004896 missense probably damaging 1.00
R1464:Ahnak UTSW 19 9004896 missense probably damaging 1.00
R1466:Ahnak UTSW 19 9015875 missense probably damaging 1.00
R1466:Ahnak UTSW 19 9015875 missense probably damaging 1.00
R1471:Ahnak UTSW 19 9012932 intron probably benign
R1507:Ahnak UTSW 19 9010077 missense probably damaging 1.00
R1521:Ahnak UTSW 19 9004728 missense probably benign 0.11
R1568:Ahnak UTSW 19 9002375 missense probably damaging 0.98
R1569:Ahnak UTSW 19 9004094 missense possibly damaging 0.78
R1616:Ahnak UTSW 19 9008987 missense possibly damaging 0.94
R1638:Ahnak UTSW 19 9009449 missense probably benign 0.01
R1680:Ahnak UTSW 19 9009963 missense probably benign 0.05
R1713:Ahnak UTSW 19 9011809 missense possibly damaging 0.95
R1722:Ahnak UTSW 19 9010655 missense probably damaging 0.99
R1771:Ahnak UTSW 19 9013753 missense probably benign 0.24
R1795:Ahnak UTSW 19 9002438 missense possibly damaging 0.79
R1823:Ahnak UTSW 19 9004905 missense probably damaging 0.99
R1842:Ahnak UTSW 19 9005867 missense probably damaging 0.99
R1854:Ahnak UTSW 19 9013832 missense possibly damaging 0.61
R1856:Ahnak UTSW 19 9002048 missense possibly damaging 0.86
R1886:Ahnak UTSW 19 9015979 missense probably damaging 0.98
R1888:Ahnak UTSW 19 9007088 missense probably damaging 1.00
R1888:Ahnak UTSW 19 9007088 missense probably damaging 1.00
R1912:Ahnak UTSW 19 9017881 missense probably damaging 1.00
R1913:Ahnak UTSW 19 9007922 missense probably damaging 0.99
R1942:Ahnak UTSW 19 9015083 missense probably damaging 0.98
R1987:Ahnak UTSW 19 9015251 missense probably damaging 1.00
R2006:Ahnak UTSW 19 9007075 missense probably damaging 1.00
R2013:Ahnak UTSW 19 9014573 missense probably damaging 0.98
R2014:Ahnak UTSW 19 9013181 missense probably damaging 0.99
R2047:Ahnak UTSW 19 9014300 missense possibly damaging 0.67
R2048:Ahnak UTSW 19 9007056 missense probably damaging 0.99
R2060:Ahnak UTSW 19 9008041 missense probably benign 0.08
R2083:Ahnak UTSW 19 9011557 missense probably damaging 1.00
R2157:Ahnak UTSW 19 9000684 missense possibly damaging 0.92
R2167:Ahnak UTSW 19 9011494 nonsense probably null
R2208:Ahnak UTSW 19 9017732 missense probably benign 0.00
R2224:Ahnak UTSW 19 9012991 intron probably benign
R2268:Ahnak UTSW 19 9010574 missense possibly damaging 0.66
R2420:Ahnak UTSW 19 9009256 missense possibly damaging 0.89
R2426:Ahnak UTSW 19 9002851 missense possibly damaging 0.81
R2910:Ahnak UTSW 19 9011654 missense probably damaging 0.99
R2911:Ahnak UTSW 19 9011654 missense probably damaging 0.99
R2981:Ahnak UTSW 19 9000148 missense probably damaging 0.97
R3151:Ahnak UTSW 19 9009944 missense probably benign 0.12
R3155:Ahnak UTSW 19 9010177 missense possibly damaging 0.49
R3422:Ahnak UTSW 19 9005708 missense probably benign 0.39
R3422:Ahnak UTSW 19 9006752 missense probably benign 0.05
R3430:Ahnak UTSW 19 9006958 missense probably benign 0.42
R3433:Ahnak UTSW 19 9009994 missense probably benign 0.01
R3711:Ahnak UTSW 19 9007898 missense probably benign
R3723:Ahnak UTSW 19 9016853 missense possibly damaging 0.79
R3775:Ahnak UTSW 19 9009023 missense possibly damaging 0.91
R3858:Ahnak UTSW 19 9010859 missense possibly damaging 0.82
R3859:Ahnak UTSW 19 9010859 missense possibly damaging 0.82
R3922:Ahnak UTSW 19 9006328 missense probably benign 0.20
R3924:Ahnak UTSW 19 9006328 missense probably benign 0.20
R3926:Ahnak UTSW 19 9006328 missense probably benign 0.20
R4026:Ahnak UTSW 19 9011299 missense probably damaging 0.97
R4051:Ahnak UTSW 19 9014327 missense probably damaging 1.00
R4209:Ahnak UTSW 19 9002600 missense probably damaging 1.00
R4234:Ahnak UTSW 19 9000786 nonsense probably null
R4237:Ahnak UTSW 19 9001783 missense probably benign 0.02
R4285:Ahnak UTSW 19 9016839 nonsense probably null
R4331:Ahnak UTSW 19 9015820 missense probably damaging 1.00
R4342:Ahnak UTSW 19 9012083 missense possibly damaging 0.79
R4430:Ahnak UTSW 19 9003040 missense probably benign 0.00
R4554:Ahnak UTSW 19 9014930 missense probably damaging 1.00
R4602:Ahnak UTSW 19 9010825 missense possibly damaging 0.66
R4612:Ahnak UTSW 19 9003724 missense probably benign 0.44
R4655:Ahnak UTSW 19 9008701 missense probably damaging 1.00
R4656:Ahnak UTSW 19 9004855 missense possibly damaging 0.80
R4700:Ahnak UTSW 19 9004681 missense probably benign 0.02
R4704:Ahnak UTSW 19 9012258 intron probably benign
R4704:Ahnak UTSW 19 9013181 missense probably damaging 0.99
R4705:Ahnak UTSW 19 9016906 missense probably benign 0.07
R4707:Ahnak UTSW 19 9016735 missense probably benign 0.03
R4732:Ahnak UTSW 19 9007301 missense probably damaging 1.00
R4733:Ahnak UTSW 19 9007301 missense probably damaging 1.00
R4778:Ahnak UTSW 19 9011975 missense possibly damaging 0.79
R4782:Ahnak UTSW 19 9012499 intron probably benign
R4832:Ahnak UTSW 19 9012460 intron probably benign
R4882:Ahnak UTSW 19 9005897 missense probably damaging 0.98
R4884:Ahnak UTSW 19 9012754 intron probably benign
R4895:Ahnak UTSW 19 9017441 missense probably benign 0.43
R4930:Ahnak UTSW 19 9010967 missense possibly damaging 0.79
R4951:Ahnak UTSW 19 9017835 missense probably damaging 1.00
R4968:Ahnak UTSW 19 9015100 missense probably damaging 1.00
R5026:Ahnak UTSW 19 9010631 missense possibly damaging 0.46
R5050:Ahnak UTSW 19 9012458 intron probably benign
R5073:Ahnak UTSW 19 9003231 missense probably benign 0.42
R5110:Ahnak UTSW 19 9014759 missense probably damaging 1.00
R5119:Ahnak UTSW 19 9013644 missense probably benign 0.00
R5128:Ahnak UTSW 19 9017087 missense probably damaging 1.00
R5139:Ahnak UTSW 19 9004655 missense probably damaging 1.00
R5150:Ahnak UTSW 19 9010904 missense possibly damaging 0.46
R5151:Ahnak UTSW 19 9017569 missense probably benign 0.03
R5165:Ahnak UTSW 19 9015665 missense possibly damaging 0.95
R5236:Ahnak UTSW 19 9000684 missense possibly damaging 0.92
R5361:Ahnak UTSW 19 9015341 missense possibly damaging 0.92
R5366:Ahnak UTSW 19 9016735 missense possibly damaging 0.65
R5387:Ahnak UTSW 19 9003691 missense probably damaging 1.00
R5396:Ahnak UTSW 19 9007175 missense probably damaging 0.99
R5583:Ahnak UTSW 19 9006917 missense probably damaging 0.99
R5587:Ahnak UTSW 19 9009476 missense possibly damaging 0.88
R5620:Ahnak UTSW 19 9013094 nonsense probably null
R5643:Ahnak UTSW 19 9010657 missense possibly damaging 0.66
R5644:Ahnak UTSW 19 9010657 missense possibly damaging 0.66
R5657:Ahnak UTSW 19 9014615 missense probably damaging 0.99
R5688:Ahnak UTSW 19 9002519 missense probably benign 0.01
R5702:Ahnak UTSW 19 9001840 missense probably damaging 1.00
R5727:Ahnak UTSW 19 9016747 missense probably damaging 0.99
R5730:Ahnak UTSW 19 9010253 missense possibly damaging 0.81
R5755:Ahnak UTSW 19 9001732 missense probably benign 0.06
R5760:Ahnak UTSW 19 9013562 missense probably damaging 1.00
R5789:Ahnak UTSW 19 9002321 missense probably benign 0.00
R5790:Ahnak UTSW 19 9015248 missense probably damaging 0.99
R5795:Ahnak UTSW 19 9012382 nonsense probably null
R5808:Ahnak UTSW 19 9010235 missense possibly damaging 0.91
R5867:Ahnak UTSW 19 9010052 missense probably damaging 0.99
R5878:Ahnak UTSW 19 9008342 missense probably damaging 1.00
R5898:Ahnak UTSW 19 9013767 missense possibly damaging 0.63
R5898:Ahnak UTSW 19 9018211 missense probably damaging 1.00
R5912:Ahnak UTSW 19 9011903 missense probably damaging 0.99
R5935:Ahnak UTSW 19 9015182 missense possibly damaging 0.91
R5969:Ahnak UTSW 19 9016585 missense probably damaging 1.00
R5988:Ahnak UTSW 19 9009347 intron probably benign
R6000:Ahnak UTSW 19 9013111 nonsense probably null
R6005:Ahnak UTSW 19 9015161 missense possibly damaging 0.61
R6101:Ahnak UTSW 19 9004099 missense probably benign 0.20
R6105:Ahnak UTSW 19 9004099 missense probably benign 0.20
R6116:Ahnak UTSW 19 9012963 intron probably benign
R6209:Ahnak UTSW 19 9012566 missense probably damaging 1.00
R6240:Ahnak UTSW 19 9013583 missense probably damaging 1.00
R6263:Ahnak UTSW 19 9018277 missense probably benign 0.03
R6287:Ahnak UTSW 19 9015003 missense probably benign 0.02
R6296:Ahnak UTSW 19 9003305 missense probably damaging 0.99
R6315:Ahnak UTSW 19 9006626 missense probably damaging 0.99
R6328:Ahnak UTSW 19 9007148 missense probably benign 0.11
R6331:Ahnak UTSW 19 9006625 missense probably benign 0.18
R6355:Ahnak UTSW 19 9008762 missense probably benign 0.02
R6409:Ahnak UTSW 19 9009574 missense probably benign 0.31
R6567:Ahnak UTSW 19 9008806 missense probably benign 0.27
R6572:Ahnak UTSW 19 9007976 missense probably damaging 0.99
R6574:Ahnak UTSW 19 9017047 missense probably benign 0.04
R6590:Ahnak UTSW 19 9009581 missense probably benign 0.29
R6620:Ahnak UTSW 19 9015310 missense possibly damaging 0.95
R6690:Ahnak UTSW 19 9009581 missense probably benign 0.29
R6731:Ahnak UTSW 19 9011562 missense possibly damaging 0.85
R6756:Ahnak UTSW 19 9007561 missense possibly damaging 0.59
R6846:Ahnak UTSW 19 9011857 missense possibly damaging 0.66
R6854:Ahnak UTSW 19 9015235 missense probably damaging 1.00
R6857:Ahnak UTSW 19 9037168 nonsense probably null
R6863:Ahnak UTSW 19 9012365 intron probably benign
R6876:Ahnak UTSW 19 9014120 missense probably damaging 0.99
R6958:Ahnak UTSW 19 9015215 missense possibly damaging 0.88
R7126:Ahnak UTSW 19 9002359 missense possibly damaging 0.61
R7181:Ahnak UTSW 19 9013488 missense probably damaging 1.00
R7183:Ahnak UTSW 19 9017668 missense probably damaging 1.00
R7202:Ahnak UTSW 19 9017799 missense probably damaging 1.00
R7235:Ahnak UTSW 19 9012488 missense unknown
R7241:Ahnak UTSW 19 9009031 missense possibly damaging 0.65
R7269:Ahnak UTSW 19 9006617 missense probably damaging 1.00
R7311:Ahnak UTSW 19 9002143 missense probably benign 0.04
R7311:Ahnak UTSW 19 9009827 missense possibly damaging 0.56
R7329:Ahnak UTSW 19 9001792 missense probably damaging 0.99
R7339:Ahnak UTSW 19 9008165 missense possibly damaging 0.75
R7390:Ahnak UTSW 19 9003205 missense probably benign 0.02
R7400:Ahnak UTSW 19 9014613 missense probably damaging 0.99
R7444:Ahnak UTSW 19 9007423 missense probably benign 0.08
R7483:Ahnak UTSW 19 9004822 missense probably damaging 1.00
R7498:Ahnak UTSW 19 9012019 missense probably benign 0.14
R7521:Ahnak UTSW 19 9002351 missense possibly damaging 0.89
R7522:Ahnak UTSW 19 9002322 missense probably benign 0.01
R7552:Ahnak UTSW 19 9006824 missense probably benign 0.18
R7563:Ahnak UTSW 19 9011165 missense probably damaging 0.99
R7565:Ahnak UTSW 19 9016156 missense probably benign 0.05
R7571:Ahnak UTSW 19 9000786 nonsense probably null
R7583:Ahnak UTSW 19 9006093 missense possibly damaging 0.90
R7600:Ahnak UTSW 19 9004574 missense possibly damaging 0.89
R7771:Ahnak UTSW 19 9015047 missense probably damaging 0.99
R7787:Ahnak UTSW 19 9009315 missense unknown
R7827:Ahnak UTSW 19 9005344 nonsense probably null
R7857:Ahnak UTSW 19 9007468 missense probably damaging 0.97
R7916:Ahnak UTSW 19 9005832 missense possibly damaging 0.66
R7939:Ahnak UTSW 19 9014084 nonsense probably null
R7959:Ahnak UTSW 19 9010649 missense possibly damaging 0.46
R7962:Ahnak UTSW 19 9012800 missense unknown
R7979:Ahnak UTSW 19 9011432 missense probably damaging 1.00
R8006:Ahnak UTSW 19 9012083 missense possibly damaging 0.79
R8013:Ahnak UTSW 19 9009335 missense unknown
R8033:Ahnak UTSW 19 9003710 missense probably benign 0.10
R8124:Ahnak UTSW 19 9007123 missense probably damaging 0.99
R8125:Ahnak UTSW 19 9011876 missense possibly damaging 0.95
R8129:Ahnak UTSW 19 9000100 start codon destroyed not run
R8151:Ahnak UTSW 19 9004679 missense possibly damaging 0.59
R8190:Ahnak UTSW 19 9002255 missense probably benign 0.01
R8221:Ahnak UTSW 19 9010436 nonsense probably null
R8241:Ahnak UTSW 19 9007295 missense probably benign 0.15
R8244:Ahnak UTSW 19 9015673 missense probably benign 0.44
R8248:Ahnak UTSW 19 9001946 missense probably damaging 1.00
R8261:Ahnak UTSW 19 9005453 missense probably damaging 1.00
R8330:Ahnak UTSW 19 9009662 missense possibly damaging 0.86
R8380:Ahnak UTSW 19 9017855 missense probably benign 0.05
R8407:Ahnak UTSW 19 9015673 missense probably benign 0.44
R8409:Ahnak UTSW 19 9015673 missense probably benign 0.44
R8463:Ahnak UTSW 19 9008749 missense probably benign 0.07
R8511:Ahnak UTSW 19 9012355 missense unknown
R8528:Ahnak UTSW 19 9007728 missense probably damaging 1.00
R8549:Ahnak UTSW 19 9011483 missense probably damaging 1.00
R8674:Ahnak UTSW 19 9005996 missense probably damaging 0.98
R8716:Ahnak UTSW 19 9009074 missense probably damaging 1.00
R8722:Ahnak UTSW 19 9013346 nonsense probably null
R8751:Ahnak UTSW 19 9010145 missense probably damaging 1.00
R8752:Ahnak UTSW 19 9015537 missense probably damaging 1.00
R8783:Ahnak UTSW 19 9011473 missense probably damaging 1.00
R8844:Ahnak UTSW 19 9006890 missense probably damaging 1.00
R8859:Ahnak UTSW 19 9007203 missense probably damaging 1.00
R8882:Ahnak UTSW 19 9000742 missense probably damaging 1.00
R8907:Ahnak UTSW 19 9009088 missense probably benign 0.24
R8938:Ahnak UTSW 19 9011735 missense probably benign 0.00
R8975:Ahnak UTSW 19 9012737 missense probably damaging 1.00
R8983:Ahnak UTSW 19 9004113 missense possibly damaging 0.75
R9017:Ahnak UTSW 19 9010123 missense probably damaging 1.00
R9027:Ahnak UTSW 19 9007253 missense possibly damaging 0.94
R9081:Ahnak UTSW 19 9008526 missense possibly damaging 0.81
R9104:Ahnak UTSW 19 9010347 missense probably benign 0.01
R9112:Ahnak UTSW 19 9009785 missense probably damaging 0.98
R9145:Ahnak UTSW 19 9014923 missense probably benign 0.38
R9189:Ahnak UTSW 19 9010883 missense possibly damaging 0.92
R9221:Ahnak UTSW 19 9012579 missense probably damaging 1.00
R9261:Ahnak UTSW 19 9016139 missense possibly damaging 0.63
R9299:Ahnak UTSW 19 9012460 intron probably benign
R9325:Ahnak UTSW 19 9013893 missense probably benign 0.12
R9337:Ahnak UTSW 19 9012460 intron probably benign
R9340:Ahnak UTSW 19 9017047 missense probably benign 0.04
R9351:Ahnak UTSW 19 9007868 missense probably damaging 1.00
R9416:Ahnak UTSW 19 9012902 missense unknown
R9462:Ahnak UTSW 19 9003935 missense probably damaging 0.96
R9469:Ahnak UTSW 19 9010861 missense probably damaging 1.00
RF007:Ahnak UTSW 19 9013601 missense possibly damaging 0.45
X0021:Ahnak UTSW 19 9013619 missense probably damaging 0.99
X0027:Ahnak UTSW 19 9012037 missense probably damaging 1.00
Z1088:Ahnak UTSW 19 9016082 missense probably damaging 0.99
Z1176:Ahnak UTSW 19 9008856 missense probably damaging 0.97
Z1177:Ahnak UTSW 19 9017468 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2018-02-28