Incidental Mutation 'R6255:Cyp2c55'
ID 506084
Institutional Source Beutler Lab
Gene Symbol Cyp2c55
Ensembl Gene ENSMUSG00000025002
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 55
Synonyms 2010318C06Rik
MMRRC Submission 044372-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R6255 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 39007019-39042693 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 39018667 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 169 (I169T)
Ref Sequence ENSEMBL: ENSMUSP00000025966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025966]
AlphaFold Q9D816
Predicted Effect probably benign
Transcript: ENSMUST00000025966
AA Change: I169T

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025966
Gene: ENSMUSG00000025002
AA Change: I169T

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
Pfam:p450 30 487 1.1e-154 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum but its specific substrate has not yet been determined. The gene is located within a cluster of cytochrome P450 genes on chromosome 10q24. An additional gene, CYP2C17, was once thought to exist; however, CYP2C17 is now considered an artefact based on a chimera of CYP2C18 and CYP2C19. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,123 V7E possibly damaging Het
Aars2 G A 17: 45,514,609 G333S probably damaging Het
Aen T A 7: 78,905,844 I85N probably damaging Het
Ahnak C A 19: 9,008,025 H2224Q possibly damaging Het
Aldh18a1 C T 19: 40,580,043 R41H possibly damaging Het
Bpifb9b T A 2: 154,309,364 W2R probably damaging Het
Caprin2 A G 6: 148,877,892 I139T probably benign Het
Cdhr3 T A 12: 33,053,475 N381I probably damaging Het
Cecr2 A G 6: 120,758,050 Y721C probably damaging Het
Cherp G T 8: 72,470,881 A125D probably damaging Het
Cped1 G A 6: 22,138,715 probably null Het
Ctdp1 T A 18: 80,459,297 probably null Het
Cyp4a31 T C 4: 115,574,920 L418P possibly damaging Het
Efcab7 T C 4: 99,829,390 probably benign Het
Efcab8 T C 2: 153,810,268 W466R possibly damaging Het
Ehd3 C A 17: 73,805,413 N57K probably benign Het
Ern2 C A 7: 122,173,272 K654N probably damaging Het
Fbxo18 A T 2: 11,748,446 F879L probably benign Het
Gde1 T C 7: 118,691,781 D92G probably null Het
Gm4788 A T 1: 139,753,011 C256* probably null Het
Heatr5b A G 17: 78,803,434 V995A probably damaging Het
Ifrd2 A G 9: 107,592,091 E346G probably damaging Het
Ism1 AACGGACCCGTTCTTGTGGCTATGCA AA 2: 139,746,042 probably benign Het
Itgb4 T C 11: 115,998,137 V1102A possibly damaging Het
Itgb6 A T 2: 60,605,276 I710N probably damaging Het
Kif1a T C 1: 93,019,983 K1578E probably damaging Het
Kif9 T C 9: 110,517,834 probably null Het
Kitl T C 10: 100,089,233 *57Q probably null Het
Lrat C A 3: 82,903,505 V70F probably damaging Het
Lrrc9 T A 12: 72,487,023 M1022K probably benign Het
Muc16 T C 9: 18,655,599 T1875A unknown Het
Mup4 T A 4: 59,957,890 N171I probably damaging Het
Npas4 G A 19: 4,986,375 T587I probably damaging Het
Oas3 A G 5: 120,771,230 V217A probably benign Het
Olfr786 A G 10: 129,437,688 N292S possibly damaging Het
Osbp C A 19: 11,977,953 A323D possibly damaging Het
Panx2 G A 15: 89,067,618 R96H probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Piezo2 T C 18: 63,121,270 R385G possibly damaging Het
Pkn2 T C 3: 142,811,599 T476A probably damaging Het
Plekha4 T C 7: 45,553,802 probably benign Het
Ppfibp2 T C 7: 107,681,762 S94P probably damaging Het
Pramel7 T A 2: 87,489,663 I429L probably benign Het
Rif1 A G 2: 52,085,053 K325E probably damaging Het
Ror2 T C 13: 53,110,542 Y826C probably damaging Het
Rsph10b G A 5: 143,959,746 G19R probably damaging Het
Slc20a1 A G 2: 129,208,004 N361D probably damaging Het
Slc26a9 A G 1: 131,763,909 D630G probably benign Het
Smtnl2 G A 11: 72,401,399 A274V probably damaging Het
Trank1 T C 9: 111,352,246 probably null Het
Tspan10 T A 11: 120,444,542 C159* probably null Het
Uba6 G A 5: 86,164,765 T23I probably benign Het
Vmn2r74 T C 7: 85,952,451 T660A possibly damaging Het
Vwa5b1 T C 4: 138,578,672 N905S probably benign Het
Zfp831 T C 2: 174,646,421 L963P possibly damaging Het
Zfp990 T A 4: 145,537,789 N452K probably benign Het
Other mutations in Cyp2c55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Cyp2c55 APN 19 39011746 missense probably benign 0.41
IGL00537:Cyp2c55 APN 19 39011706 missense possibly damaging 0.93
IGL00959:Cyp2c55 APN 19 39038143 missense probably benign 0.00
IGL01140:Cyp2c55 APN 19 39018649 missense probably benign
IGL01792:Cyp2c55 APN 19 39042187 missense probably benign
PIT4453001:Cyp2c55 UTSW 19 39011791 missense probably damaging 1.00
R0472:Cyp2c55 UTSW 19 39031379 missense probably benign 0.01
R1452:Cyp2c55 UTSW 19 39011090 missense probably damaging 1.00
R1468:Cyp2c55 UTSW 19 39011081 missense probably damaging 0.96
R1468:Cyp2c55 UTSW 19 39011081 missense probably damaging 0.96
R1925:Cyp2c55 UTSW 19 39034377 missense probably benign 0.06
R2154:Cyp2c55 UTSW 19 39034375 missense probably damaging 1.00
R3814:Cyp2c55 UTSW 19 39007065 missense probably damaging 1.00
R4021:Cyp2c55 UTSW 19 39035434 splice site probably null
R4022:Cyp2c55 UTSW 19 39035434 splice site probably null
R4293:Cyp2c55 UTSW 19 39011791 missense probably damaging 1.00
R4294:Cyp2c55 UTSW 19 39011791 missense probably damaging 1.00
R4604:Cyp2c55 UTSW 19 39031386 missense possibly damaging 0.82
R4740:Cyp2c55 UTSW 19 39018729 missense probably benign
R4756:Cyp2c55 UTSW 19 39031371 missense probably damaging 1.00
R4879:Cyp2c55 UTSW 19 39042078 frame shift probably null
R5039:Cyp2c55 UTSW 19 39038143 missense probably benign 0.00
R5672:Cyp2c55 UTSW 19 39035546 missense probably benign 0.02
R5834:Cyp2c55 UTSW 19 39042067 missense probably benign 0.00
R6198:Cyp2c55 UTSW 19 39007121 nonsense probably null
R6431:Cyp2c55 UTSW 19 39031409 missense probably damaging 0.99
R6565:Cyp2c55 UTSW 19 39042122 missense probably benign 0.09
R7934:Cyp2c55 UTSW 19 39042091 missense probably damaging 1.00
R8477:Cyp2c55 UTSW 19 39011041 missense probably damaging 0.97
R8865:Cyp2c55 UTSW 19 39031434 missense probably benign 0.21
R8904:Cyp2c55 UTSW 19 39034372 missense
R8960:Cyp2c55 UTSW 19 39007103 missense probably null 1.00
R9012:Cyp2c55 UTSW 19 39042116 missense probably benign 0.00
R9037:Cyp2c55 UTSW 19 39042093 missense probably damaging 1.00
R9047:Cyp2c55 UTSW 19 39031346 missense possibly damaging 0.55
R9164:Cyp2c55 UTSW 19 39007127 nonsense probably null
X0062:Cyp2c55 UTSW 19 39018689 missense probably damaging 0.98
Z1176:Cyp2c55 UTSW 19 39035513 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGAAGACATGAATTGTTATGTGTTCT -3'
(R):5'- CTGTACACGATTCCTTGTGAAG -3'

Sequencing Primer
(F):5'- GCCATGTCTACAGAGAGAGTTCC -3'
(R):5'- GAGAATATCTTTGACTCACCTGC -3'
Posted On 2018-02-28