Incidental Mutation 'R6255:Aldh18a1'
ID 506085
Institutional Source Beutler Lab
Gene Symbol Aldh18a1
Ensembl Gene ENSMUSG00000025007
Gene Name aldehyde dehydrogenase 18 family, member A1
Synonyms 2810433K04Rik, Pycs
MMRRC Submission 044372-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6255 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 40550257-40588463 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 40580043 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 41 (R41H)
Ref Sequence ENSEMBL: ENSMUSP00000115429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025979] [ENSMUST00000149476] [ENSMUST00000175932] [ENSMUST00000176939] [ENSMUST00000176955]
AlphaFold Q9Z110
Predicted Effect possibly damaging
Transcript: ENSMUST00000025979
AA Change: R41H

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025979
Gene: ENSMUSG00000025007
AA Change: R41H

DomainStartEndE-ValueType
Pfam:AA_kinase 71 329 1e-41 PFAM
Pfam:Aldedh 350 659 3.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134749
Predicted Effect possibly damaging
Transcript: ENSMUST00000149476
AA Change: R41H

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115429
Gene: ENSMUSG00000025007
AA Change: R41H

DomainStartEndE-ValueType
Pfam:AA_kinase 71 173 3.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175932
Predicted Effect possibly damaging
Transcript: ENSMUST00000176939
AA Change: R41H

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135426
Gene: ENSMUSG00000025007
AA Change: R41H

DomainStartEndE-ValueType
Pfam:AA_kinase 71 327 1.9e-39 PFAM
Pfam:Aldedh 351 665 3.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176955
SMART Domains Protein: ENSMUSP00000135759
Gene: ENSMUSG00000025007

DomainStartEndE-ValueType
PDB:4Q1T|D 1 83 1e-5 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the aldehyde dehydrogenase family and encodes a bifunctional ATP- and NADPH-dependent mitochondrial enzyme with both gamma-glutamyl kinase and gamma-glutamyl phosphate reductase activities. The encoded protein catalyzes the reduction of glutamate to delta1-pyrroline-5-carboxylate, a critical step in the de novo biosynthesis of proline, ornithine and arginine. Mutations in this gene lead to hyperammonemia, hypoornithinemia, hypocitrullinemia, hypoargininemia and hypoprolinemia and may be associated with neurodegeneration, cataracts and connective tissue diseases. Alternatively spliced transcript variants, encoding different isoforms, have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,123 (GRCm38) V7E possibly damaging Het
Aars2 G A 17: 45,514,609 (GRCm38) G333S probably damaging Het
Aen T A 7: 78,905,844 (GRCm38) I85N probably damaging Het
Ahnak C A 19: 9,008,025 (GRCm38) H2224Q possibly damaging Het
Bpifb9b T A 2: 154,309,364 (GRCm38) W2R probably damaging Het
Caprin2 A G 6: 148,877,892 (GRCm38) I139T probably benign Het
Cdhr3 T A 12: 33,053,475 (GRCm38) N381I probably damaging Het
Cecr2 A G 6: 120,758,050 (GRCm38) Y721C probably damaging Het
Cfhr4 A T 1: 139,753,011 (GRCm38) C256* probably null Het
Cherp G T 8: 72,470,881 (GRCm38) A125D probably damaging Het
Cped1 G A 6: 22,138,715 (GRCm38) probably null Het
Ctdp1 T A 18: 80,459,297 (GRCm38) probably null Het
Cyp2c55 T C 19: 39,018,667 (GRCm38) I169T probably benign Het
Cyp4a31 T C 4: 115,574,920 (GRCm38) L418P possibly damaging Het
Efcab7 T C 4: 99,829,390 (GRCm38) probably benign Het
Efcab8 T C 2: 153,810,268 (GRCm38) W466R possibly damaging Het
Ehd3 C A 17: 73,805,413 (GRCm38) N57K probably benign Het
Ern2 C A 7: 122,173,272 (GRCm38) K654N probably damaging Het
Fbh1 A T 2: 11,748,446 (GRCm38) F879L probably benign Het
Gde1 T C 7: 118,691,781 (GRCm38) D92G probably null Het
Heatr5b A G 17: 78,803,434 (GRCm38) V995A probably damaging Het
Ifrd2 A G 9: 107,592,091 (GRCm38) E346G probably damaging Het
Ism1 AACGGACCCGTTCTTGTGGCTATGCA AA 2: 139,746,042 (GRCm38) probably benign Het
Itgb4 T C 11: 115,998,137 (GRCm38) V1102A possibly damaging Het
Itgb6 A T 2: 60,605,276 (GRCm38) I710N probably damaging Het
Kif1a T C 1: 93,019,983 (GRCm38) K1578E probably damaging Het
Kif9 T C 9: 110,517,834 (GRCm38) probably null Het
Kitl T C 10: 100,089,233 (GRCm38) *57Q probably null Het
Lrat C A 3: 82,903,505 (GRCm38) V70F probably damaging Het
Lrrc9 T A 12: 72,487,023 (GRCm38) M1022K probably benign Het
Muc16 T C 9: 18,655,599 (GRCm38) T1875A unknown Het
Mup4 T A 4: 59,957,890 (GRCm38) N171I probably damaging Het
Npas4 G A 19: 4,986,375 (GRCm38) T587I probably damaging Het
Oas3 A G 5: 120,771,230 (GRCm38) V217A probably benign Het
Or6c1b A G 10: 129,437,688 (GRCm38) N292S possibly damaging Het
Osbp C A 19: 11,977,953 (GRCm38) A323D possibly damaging Het
Panx2 G A 15: 89,067,618 (GRCm38) R96H probably damaging Het
Pcdhb18 G A 18: 37,490,484 (GRCm38) R289Q probably benign Het
Piezo2 T C 18: 63,121,270 (GRCm38) R385G possibly damaging Het
Pkn2 T C 3: 142,811,599 (GRCm38) T476A probably damaging Het
Plekha4 T C 7: 45,553,802 (GRCm38) probably benign Het
Ppfibp2 T C 7: 107,681,762 (GRCm38) S94P probably damaging Het
Pramel7 T A 2: 87,489,663 (GRCm38) I429L probably benign Het
Rif1 A G 2: 52,085,053 (GRCm38) K325E probably damaging Het
Ror2 T C 13: 53,110,542 (GRCm38) Y826C probably damaging Het
Rsph10b G A 5: 143,959,746 (GRCm38) G19R probably damaging Het
Slc20a1 A G 2: 129,208,004 (GRCm38) N361D probably damaging Het
Slc26a9 A G 1: 131,763,909 (GRCm38) D630G probably benign Het
Smtnl2 G A 11: 72,401,399 (GRCm38) A274V probably damaging Het
Trank1 T C 9: 111,352,246 (GRCm38) probably null Het
Tspan10 T A 11: 120,444,542 (GRCm38) C159* probably null Het
Uba6 G A 5: 86,164,765 (GRCm38) T23I probably benign Het
Vmn2r74 T C 7: 85,952,451 (GRCm38) T660A possibly damaging Het
Vwa5b1 T C 4: 138,578,672 (GRCm38) N905S probably benign Het
Zfp831 T C 2: 174,646,421 (GRCm38) L963P possibly damaging Het
Zfp990 T A 4: 145,537,789 (GRCm38) N452K probably benign Het
Other mutations in Aldh18a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Aldh18a1 APN 19 40,569,181 (GRCm38) splice site probably benign
IGL02353:Aldh18a1 APN 19 40,577,920 (GRCm38) missense probably damaging 0.98
IGL02360:Aldh18a1 APN 19 40,577,920 (GRCm38) missense probably damaging 0.98
IGL02974:Aldh18a1 APN 19 40,569,084 (GRCm38) missense probably damaging 0.96
IGL03295:Aldh18a1 APN 19 40,562,942 (GRCm38) missense probably damaging 1.00
PIT4498001:Aldh18a1 UTSW 19 40,574,356 (GRCm38) missense probably benign
R0267:Aldh18a1 UTSW 19 40,573,789 (GRCm38) missense probably benign 0.25
R0498:Aldh18a1 UTSW 19 40,574,272 (GRCm38) missense probably benign 0.29
R1140:Aldh18a1 UTSW 19 40,574,285 (GRCm38) missense probably benign 0.01
R1142:Aldh18a1 UTSW 19 40,551,213 (GRCm38) missense probably damaging 0.97
R1509:Aldh18a1 UTSW 19 40,557,483 (GRCm38) missense probably damaging 0.98
R1640:Aldh18a1 UTSW 19 40,585,499 (GRCm38) missense probably benign
R1721:Aldh18a1 UTSW 19 40,564,838 (GRCm38) missense probably damaging 1.00
R3012:Aldh18a1 UTSW 19 40,557,691 (GRCm38) nonsense probably null
R3085:Aldh18a1 UTSW 19 40,574,369 (GRCm38) missense probably benign
R3815:Aldh18a1 UTSW 19 40,570,500 (GRCm38) missense probably damaging 1.00
R3863:Aldh18a1 UTSW 19 40,551,314 (GRCm38) missense probably damaging 1.00
R4156:Aldh18a1 UTSW 19 40,551,281 (GRCm38) missense probably damaging 1.00
R5116:Aldh18a1 UTSW 19 40,553,505 (GRCm38) missense probably benign
R5135:Aldh18a1 UTSW 19 40,554,817 (GRCm38) intron probably benign
R5393:Aldh18a1 UTSW 19 40,585,567 (GRCm38) missense probably benign 0.00
R5492:Aldh18a1 UTSW 19 40,551,290 (GRCm38) missense probably damaging 1.00
R5493:Aldh18a1 UTSW 19 40,551,290 (GRCm38) missense probably damaging 1.00
R5494:Aldh18a1 UTSW 19 40,551,290 (GRCm38) missense probably damaging 1.00
R5957:Aldh18a1 UTSW 19 40,570,537 (GRCm38) nonsense probably null
R6320:Aldh18a1 UTSW 19 40,570,561 (GRCm38) missense probably benign 0.44
R6358:Aldh18a1 UTSW 19 40,577,678 (GRCm38) missense possibly damaging 0.83
R6379:Aldh18a1 UTSW 19 40,577,770 (GRCm38) critical splice donor site probably null
R6785:Aldh18a1 UTSW 19 40,568,344 (GRCm38) missense probably damaging 1.00
R7334:Aldh18a1 UTSW 19 40,551,252 (GRCm38) missense probably damaging 1.00
R7549:Aldh18a1 UTSW 19 40,564,847 (GRCm38) missense probably damaging 1.00
R7935:Aldh18a1 UTSW 19 40,573,782 (GRCm38) nonsense probably null
R7960:Aldh18a1 UTSW 19 40,557,820 (GRCm38) missense probably benign 0.03
R8152:Aldh18a1 UTSW 19 40,565,012 (GRCm38) missense probably benign 0.01
R8179:Aldh18a1 UTSW 19 40,557,508 (GRCm38) missense probably damaging 1.00
R8181:Aldh18a1 UTSW 19 40,557,437 (GRCm38) missense probably benign 0.27
R8222:Aldh18a1 UTSW 19 40,573,852 (GRCm38) missense probably benign 0.00
R8787:Aldh18a1 UTSW 19 40,557,786 (GRCm38) missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TTGGCATCAACTTGGAGACTG -3'
(R):5'- ATAATAGCTGTTTTGGGTTGCCAAG -3'

Sequencing Primer
(F):5'- CCTGGCAGTTACCTGTTCAACAATAG -3'
(R):5'- GGGTTGCCAAGCTGGTTAC -3'
Posted On 2018-02-28