Incidental Mutation 'R6256:Ppm1l'
ID506096
Institutional Source Beutler Lab
Gene Symbol Ppm1l
Ensembl Gene ENSMUSG00000027784
Gene Nameprotein phosphatase 1 (formerly 2C)-like
Synonyms5930404J21Rik, Pp2ce, PP2C-epsilon
MMRRC Submission 044373-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R6256 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location69316861-69560802 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69497897 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 176 (I176V)
Ref Sequence ENSEMBL: ENSMUSP00000029355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029355]
Predicted Effect probably benign
Transcript: ENSMUST00000029355
AA Change: I176V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029355
Gene: ENSMUSG00000027784
AA Change: I176V

DomainStartEndE-ValueType
PP2Cc 77 349 3.17e-75 SMART
PP2C_SIG 103 351 1.28e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193662
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a magnesium or manganese-requiring phosphatase that is involved in several signaling pathways. The encoded protein downregulates apoptosis signal-regulating kinase 1, a protein that initiates a signaling cascade that leads to apoptosis when cells are subjected to cytotoxic stresses. This protein also is an endoplasmic reticulum transmembrane protein that helps regulate ceramide transport from the endoplasmic reticulum to the Golgi apparatus. Finally, this gene may be involved in adiposity since it is upregulated in adipose tissues. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a null allele show increased body weight and total fat mass, higher blood pressure and plasma glucose levels, lower free fatty acid levels and improved glucose tolerance. Homozygotes for another null allele show postnatal lethality, motor deficits and altered forebrain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Ppm1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Ppm1l APN 3 69317950 missense probably damaging 1.00
IGL02834:Ppm1l APN 3 69549343 missense probably damaging 1.00
R0270:Ppm1l UTSW 3 69317976 splice site probably benign
R0310:Ppm1l UTSW 3 69549461 missense probably benign 0.39
R0557:Ppm1l UTSW 3 69497901 missense probably benign 0.39
R1577:Ppm1l UTSW 3 69553070 missense probably damaging 1.00
R3508:Ppm1l UTSW 3 69549480 missense possibly damaging 0.81
R4750:Ppm1l UTSW 3 69549328 missense probably damaging 0.99
R4864:Ppm1l UTSW 3 69542511 intron probably benign
R5007:Ppm1l UTSW 3 69317598 missense probably damaging 1.00
R5406:Ppm1l UTSW 3 69317594 missense possibly damaging 0.66
R6168:Ppm1l UTSW 3 69549407 missense probably damaging 1.00
R6474:Ppm1l UTSW 3 69553041 missense probably damaging 0.99
R6517:Ppm1l UTSW 3 69317583 missense probably damaging 0.98
R6949:Ppm1l UTSW 3 69549403 missense possibly damaging 0.90
R7029:Ppm1l UTSW 3 69553066 missense probably benign 0.16
R7086:Ppm1l UTSW 3 69317853 missense probably damaging 1.00
R7312:Ppm1l UTSW 3 69317711 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTGGAGGTTGGATCCACAGTAC -3'
(R):5'- AGAGCGTAGAGTCCTGTTTGTCC -3'

Sequencing Primer
(F):5'- GTTGGATCCACAGTACTCTGAGAAC -3'
(R):5'- AGAGTCCTGTTTGTCCTTAATCAG -3'
Posted On2018-02-28