Incidental Mutation 'R6256:Ppm1l'
ID 506096
Institutional Source Beutler Lab
Gene Symbol Ppm1l
Ensembl Gene ENSMUSG00000027784
Gene Name protein phosphatase 1 (formerly 2C)-like
Synonyms Pp2ce, 5930404J21Rik, PP2C-epsilon
MMRRC Submission 044373-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.161) question?
Stock # R6256 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 69224251-69468131 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 69405230 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 176 (I176V)
Ref Sequence ENSEMBL: ENSMUSP00000029355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029355]
AlphaFold Q8BHN0
Predicted Effect probably benign
Transcript: ENSMUST00000029355
AA Change: I176V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029355
Gene: ENSMUSG00000027784
AA Change: I176V

DomainStartEndE-ValueType
PP2Cc 77 349 3.17e-75 SMART
PP2C_SIG 103 351 1.28e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193662
Meta Mutation Damage Score 0.0697 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a magnesium or manganese-requiring phosphatase that is involved in several signaling pathways. The encoded protein downregulates apoptosis signal-regulating kinase 1, a protein that initiates a signaling cascade that leads to apoptosis when cells are subjected to cytotoxic stresses. This protein also is an endoplasmic reticulum transmembrane protein that helps regulate ceramide transport from the endoplasmic reticulum to the Golgi apparatus. Finally, this gene may be involved in adiposity since it is upregulated in adipose tissues. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a null allele show increased body weight and total fat mass, higher blood pressure and plasma glucose levels, lower free fatty acid levels and improved glucose tolerance. Homozygotes for another null allele show postnatal lethality, motor deficits and altered forebrain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 73,205,272 (GRCm39) Q361L probably damaging Het
Abca7 A G 10: 79,838,456 (GRCm39) T577A probably damaging Het
Acad12 A T 5: 121,752,149 (GRCm39) V54E probably benign Het
Ago4 A G 4: 126,414,019 (GRCm39) Y91H probably damaging Het
Akr1b10 T C 6: 34,364,623 (GRCm39) V28A probably damaging Het
Ccdc33 T A 9: 58,009,201 (GRCm39) probably null Het
Ccdc7a T C 8: 129,662,074 (GRCm39) probably null Het
Ces1f A T 8: 93,992,422 (GRCm39) V343E probably damaging Het
Cftr T C 6: 18,274,660 (GRCm39) L896P probably damaging Het
Csmd3 G A 15: 47,533,125 (GRCm39) P2375S probably damaging Het
Dnajb14 C T 3: 137,614,124 (GRCm39) A345V probably damaging Het
Dnajb14 G C 3: 137,614,123 (GRCm39) A345P probably damaging Het
Dnase1 G A 16: 3,855,485 (GRCm39) R24K probably benign Het
Dnmbp C T 19: 43,840,720 (GRCm39) V560M probably damaging Het
Dop1b T A 16: 93,604,102 (GRCm39) I1981N possibly damaging Het
Eif3a A C 19: 60,759,464 (GRCm39) S770A possibly damaging Het
Fbxl7 A T 15: 26,553,088 (GRCm39) C60S probably benign Het
Fras1 A T 5: 96,881,702 (GRCm39) D2478V possibly damaging Het
Hrnr A G 3: 93,229,918 (GRCm39) D52G probably damaging Het
Jmjd1c T A 10: 67,056,187 (GRCm39) L823M probably damaging Het
Kdm1a G T 4: 136,295,911 (GRCm39) C172* probably null Het
Kdm6b C T 11: 69,297,555 (GRCm39) E295K probably damaging Het
Mepe A T 5: 104,484,940 (GRCm39) M27L probably benign Het
Mogat2 A T 7: 98,869,102 (GRCm39) H305Q probably damaging Het
Mst1r T A 9: 107,794,465 (GRCm39) Y1215N probably damaging Het
Muc5ac A T 7: 141,343,532 (GRCm39) H48L possibly damaging Het
Myo7b T C 18: 32,116,748 (GRCm39) D953G probably damaging Het
Ocel1 T C 8: 71,824,472 (GRCm39) probably benign Het
Pcdhb6 A G 18: 37,468,978 (GRCm39) D633G probably damaging Het
Sall3 C T 18: 81,013,076 (GRCm39) R1120H possibly damaging Het
Sbf1 G A 15: 89,185,070 (GRCm39) P1018S probably benign Het
Setbp1 T C 18: 78,900,472 (GRCm39) Y1065C probably damaging Het
Slc25a2 T C 18: 37,770,776 (GRCm39) probably null Het
Slc4a2 C A 5: 24,640,888 (GRCm39) T729K probably damaging Het
Sptlc2 T C 12: 87,402,305 (GRCm39) E207G probably damaging Het
Sult6b1 A T 17: 79,214,343 (GRCm39) F27I probably benign Het
Syf2 A T 4: 134,661,889 (GRCm39) K84N probably damaging Het
Tmem209 A T 6: 30,497,166 (GRCm39) N183K probably benign Het
Tmem232 G T 17: 65,785,397 (GRCm39) Q188K possibly damaging Het
Tomm70a A T 16: 56,973,055 (GRCm39) T598S probably benign Het
Ttll13 A G 7: 79,908,052 (GRCm39) T556A probably benign Het
Vmn2r120 A T 17: 57,831,700 (GRCm39) L363* probably null Het
Xpo6 G T 7: 125,707,791 (GRCm39) Q872K probably damaging Het
Xrra1 A C 7: 99,563,671 (GRCm39) S553R probably damaging Het
Zfy1 A T Y: 738,765 (GRCm39) V147E unknown Homo
Zfy2 T C Y: 2,116,267 (GRCm39) I258V probably benign Homo
Other mutations in Ppm1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Ppm1l APN 3 69,225,283 (GRCm39) missense probably damaging 1.00
IGL02834:Ppm1l APN 3 69,456,676 (GRCm39) missense probably damaging 1.00
R0270:Ppm1l UTSW 3 69,225,309 (GRCm39) splice site probably benign
R0310:Ppm1l UTSW 3 69,456,794 (GRCm39) missense probably benign 0.39
R0557:Ppm1l UTSW 3 69,405,234 (GRCm39) missense probably benign 0.39
R1577:Ppm1l UTSW 3 69,460,403 (GRCm39) missense probably damaging 1.00
R3508:Ppm1l UTSW 3 69,456,813 (GRCm39) missense possibly damaging 0.81
R4750:Ppm1l UTSW 3 69,456,661 (GRCm39) missense probably damaging 0.99
R4864:Ppm1l UTSW 3 69,449,844 (GRCm39) intron probably benign
R5007:Ppm1l UTSW 3 69,224,931 (GRCm39) missense probably damaging 1.00
R5406:Ppm1l UTSW 3 69,224,927 (GRCm39) missense possibly damaging 0.66
R6168:Ppm1l UTSW 3 69,456,740 (GRCm39) missense probably damaging 1.00
R6474:Ppm1l UTSW 3 69,460,374 (GRCm39) missense probably damaging 0.99
R6517:Ppm1l UTSW 3 69,224,916 (GRCm39) missense probably damaging 0.98
R6949:Ppm1l UTSW 3 69,456,736 (GRCm39) missense possibly damaging 0.90
R7029:Ppm1l UTSW 3 69,460,399 (GRCm39) missense probably benign 0.16
R7086:Ppm1l UTSW 3 69,225,186 (GRCm39) missense probably damaging 1.00
R7312:Ppm1l UTSW 3 69,225,044 (GRCm39) missense probably benign 0.03
R9225:Ppm1l UTSW 3 69,460,244 (GRCm39) missense probably benign 0.13
R9329:Ppm1l UTSW 3 69,460,453 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGAGGTTGGATCCACAGTAC -3'
(R):5'- AGAGCGTAGAGTCCTGTTTGTCC -3'

Sequencing Primer
(F):5'- GTTGGATCCACAGTACTCTGAGAAC -3'
(R):5'- AGAGTCCTGTTTGTCCTTAATCAG -3'
Posted On 2018-02-28