Incidental Mutation 'R6256:Hrnr'
ID506097
Institutional Source Beutler Lab
Gene Symbol Hrnr
Ensembl Gene ENSMUSG00000041991
Gene Namehornerin
Synonyms1110033K19Rik, S100a18, A530063N20Rik
MMRRC Submission 044373-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6256 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location93319749-93333570 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93322611 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 52 (D52G)
Ref Sequence ENSEMBL: ENSMUSP00000091288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090856] [ENSMUST00000093774]
Predicted Effect probably damaging
Transcript: ENSMUST00000090856
AA Change: D52G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088369
Gene: ENSMUSG00000041991
AA Change: D52G

DomainStartEndE-ValueType
Pfam:S_100 4 47 4.8e-15 PFAM
Blast:EFh 53 81 6e-9 BLAST
internal_repeat_5 95 129 7.19e-7 PROSPERO
low complexity region 135 155 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 200 246 N/A INTRINSIC
low complexity region 255 287 N/A INTRINSIC
internal_repeat_2 288 341 5.7e-19 PROSPERO
internal_repeat_1 291 354 5.27e-23 PROSPERO
internal_repeat_3 301 355 9.03e-17 PROSPERO
internal_repeat_5 309 343 7.19e-7 PROSPERO
low complexity region 358 379 N/A INTRINSIC
low complexity region 394 415 N/A INTRINSIC
low complexity region 421 498 N/A INTRINSIC
low complexity region 501 523 N/A INTRINSIC
low complexity region 527 593 N/A INTRINSIC
low complexity region 598 675 N/A INTRINSIC
low complexity region 679 713 N/A INTRINSIC
low complexity region 723 764 N/A INTRINSIC
low complexity region 769 846 N/A INTRINSIC
low complexity region 849 871 N/A INTRINSIC
low complexity region 875 941 N/A INTRINSIC
low complexity region 946 1023 N/A INTRINSIC
low complexity region 1027 1061 N/A INTRINSIC
low complexity region 1084 1112 N/A INTRINSIC
low complexity region 1117 1194 N/A INTRINSIC
low complexity region 1197 1219 N/A INTRINSIC
low complexity region 1223 1289 N/A INTRINSIC
low complexity region 1294 1371 N/A INTRINSIC
low complexity region 1375 1409 N/A INTRINSIC
low complexity region 1419 1460 N/A INTRINSIC
low complexity region 1465 1542 N/A INTRINSIC
low complexity region 1545 1567 N/A INTRINSIC
low complexity region 1571 1637 N/A INTRINSIC
low complexity region 1642 1719 N/A INTRINSIC
low complexity region 1723 1757 N/A INTRINSIC
low complexity region 1767 1808 N/A INTRINSIC
low complexity region 1813 1890 N/A INTRINSIC
low complexity region 1893 1915 N/A INTRINSIC
low complexity region 1919 1985 N/A INTRINSIC
low complexity region 1990 2067 N/A INTRINSIC
low complexity region 2071 2105 N/A INTRINSIC
low complexity region 2115 2156 N/A INTRINSIC
low complexity region 2161 2238 N/A INTRINSIC
low complexity region 2242 2327 N/A INTRINSIC
low complexity region 2332 2409 N/A INTRINSIC
low complexity region 2413 2447 N/A INTRINSIC
low complexity region 2457 2498 N/A INTRINSIC
low complexity region 2503 2580 N/A INTRINSIC
low complexity region 2583 2605 N/A INTRINSIC
low complexity region 2609 2675 N/A INTRINSIC
low complexity region 2680 2757 N/A INTRINSIC
low complexity region 2761 2795 N/A INTRINSIC
low complexity region 2805 2846 N/A INTRINSIC
low complexity region 2851 2896 N/A INTRINSIC
internal_repeat_4 2897 2968 4.19e-13 PROSPERO
internal_repeat_3 2901 2955 9.03e-17 PROSPERO
internal_repeat_2 2920 2967 5.7e-19 PROSPERO
low complexity region 2969 2985 N/A INTRINSIC
low complexity region 3016 3034 N/A INTRINSIC
internal_repeat_1 3039 3101 5.27e-23 PROSPERO
internal_repeat_4 3045 3103 4.19e-13 PROSPERO
low complexity region 3140 3153 N/A INTRINSIC
low complexity region 3163 3174 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093774
AA Change: D52G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091288
Gene: ENSMUSG00000041991
AA Change: D52G

DomainStartEndE-ValueType
Pfam:S_100 4 46 3.1e-17 PFAM
Blast:EFh 53 81 6e-9 BLAST
internal_repeat_5 95 129 5.9e-7 PROSPERO
low complexity region 135 155 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 200 246 N/A INTRINSIC
low complexity region 255 287 N/A INTRINSIC
internal_repeat_2 288 341 3.49e-19 PROSPERO
internal_repeat_1 291 354 2.93e-23 PROSPERO
internal_repeat_3 301 355 5.83e-17 PROSPERO
internal_repeat_5 309 343 5.9e-7 PROSPERO
low complexity region 358 379 N/A INTRINSIC
low complexity region 394 415 N/A INTRINSIC
low complexity region 421 498 N/A INTRINSIC
low complexity region 501 523 N/A INTRINSIC
low complexity region 527 593 N/A INTRINSIC
low complexity region 598 675 N/A INTRINSIC
low complexity region 679 713 N/A INTRINSIC
low complexity region 723 764 N/A INTRINSIC
low complexity region 769 846 N/A INTRINSIC
low complexity region 849 871 N/A INTRINSIC
low complexity region 875 941 N/A INTRINSIC
low complexity region 946 1023 N/A INTRINSIC
low complexity region 1027 1061 N/A INTRINSIC
low complexity region 1084 1112 N/A INTRINSIC
low complexity region 1117 1194 N/A INTRINSIC
low complexity region 1197 1219 N/A INTRINSIC
low complexity region 1223 1289 N/A INTRINSIC
low complexity region 1294 1371 N/A INTRINSIC
low complexity region 1375 1409 N/A INTRINSIC
low complexity region 1419 1460 N/A INTRINSIC
low complexity region 1465 1542 N/A INTRINSIC
low complexity region 1545 1567 N/A INTRINSIC
low complexity region 1571 1637 N/A INTRINSIC
low complexity region 1642 1719 N/A INTRINSIC
low complexity region 1723 1757 N/A INTRINSIC
low complexity region 1767 1808 N/A INTRINSIC
low complexity region 1813 1890 N/A INTRINSIC
low complexity region 1893 1915 N/A INTRINSIC
low complexity region 1919 1985 N/A INTRINSIC
low complexity region 1990 2067 N/A INTRINSIC
low complexity region 2071 2105 N/A INTRINSIC
low complexity region 2115 2156 N/A INTRINSIC
low complexity region 2161 2238 N/A INTRINSIC
low complexity region 2242 2276 N/A INTRINSIC
low complexity region 2286 2327 N/A INTRINSIC
low complexity region 2332 2409 N/A INTRINSIC
low complexity region 2412 2434 N/A INTRINSIC
low complexity region 2438 2504 N/A INTRINSIC
low complexity region 2509 2586 N/A INTRINSIC
low complexity region 2590 2624 N/A INTRINSIC
low complexity region 2634 2675 N/A INTRINSIC
low complexity region 2680 2757 N/A INTRINSIC
low complexity region 2760 2782 N/A INTRINSIC
low complexity region 2786 2852 N/A INTRINSIC
low complexity region 2857 2934 N/A INTRINSIC
low complexity region 2938 2972 N/A INTRINSIC
low complexity region 2982 3023 N/A INTRINSIC
low complexity region 3028 3073 N/A INTRINSIC
internal_repeat_4 3074 3145 2.96e-13 PROSPERO
internal_repeat_3 3078 3132 5.83e-17 PROSPERO
internal_repeat_2 3097 3144 3.49e-19 PROSPERO
low complexity region 3146 3162 N/A INTRINSIC
low complexity region 3193 3211 N/A INTRINSIC
internal_repeat_1 3216 3278 2.93e-23 PROSPERO
internal_repeat_4 3222 3280 2.96e-13 PROSPERO
low complexity region 3317 3330 N/A INTRINSIC
low complexity region 3340 3351 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195137
Meta Mutation Damage Score 0.1860 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Hrnr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Hrnr APN 3 93322897 missense unknown
IGL02326:Hrnr APN 3 93323745 missense unknown
IGL03030:Hrnr APN 3 93320601 missense possibly damaging 0.91
IGL03281:Hrnr APN 3 93322851 missense probably benign 0.04
R0140:Hrnr UTSW 3 93331493 nonsense probably null
R0709:Hrnr UTSW 3 93332508 missense unknown
R1179:Hrnr UTSW 3 93332543 missense unknown
R1528:Hrnr UTSW 3 93322794 missense possibly damaging 0.56
R1640:Hrnr UTSW 3 93332516 missense unknown
R1987:Hrnr UTSW 3 93332604 missense unknown
R1988:Hrnr UTSW 3 93332604 missense unknown
R3846:Hrnr UTSW 3 93332157 missense unknown
R3871:Hrnr UTSW 3 93331874 missense unknown
R3938:Hrnr UTSW 3 93322855 missense probably benign 0.35
R4569:Hrnr UTSW 3 93323568 missense unknown
R4690:Hrnr UTSW 3 93323652 missense unknown
R4761:Hrnr UTSW 3 93322755 missense probably damaging 0.96
R5182:Hrnr UTSW 3 93332143 missense unknown
R5292:Hrnr UTSW 3 93331892 missense unknown
R5739:Hrnr UTSW 3 93323129 missense unknown
R5845:Hrnr UTSW 3 93332637 missense unknown
R5994:Hrnr UTSW 3 93332300 missense unknown
R6169:Hrnr UTSW 3 93325755 nonsense probably null
R6216:Hrnr UTSW 3 93332162 missense unknown
R6670:Hrnr UTSW 3 93331885 missense unknown
R6790:Hrnr UTSW 3 93329075 missense unknown
R6936:Hrnr UTSW 3 93332360 missense unknown
R7049:Hrnr UTSW 3 93323154 nonsense probably null
R7358:Hrnr UTSW 3 93323141 nonsense probably null
R7383:Hrnr UTSW 3 93331791 missense unknown
R7724:Hrnr UTSW 3 93323016 missense unknown
R7762:Hrnr UTSW 3 93332199 missense unknown
R7945:Hrnr UTSW 3 93332199 missense unknown
R8086:Hrnr UTSW 3 93323421 missense unknown
R8115:Hrnr UTSW 3 93323732 missense unknown
R8383:Hrnr UTSW 3 93332346 missense unknown
R8685:Hrnr UTSW 3 93322898 missense unknown
R8809:Hrnr UTSW 3 93332136 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTAACAGGCCAACTTGCTC -3'
(R):5'- TGAGCCCCTGGAATAAGAGTC -3'

Sequencing Primer
(F):5'- AACAGGCCAACTTGCTCCTCTC -3'
(R):5'- GAGCCCCTGGAATAAGAGTCATTCTC -3'
Posted On2018-02-28