Incidental Mutation 'R6256:Ago4'
ID506100
Institutional Source Beutler Lab
Gene Symbol Ago4
Ensembl Gene ENSMUSG00000042500
Gene Nameargonaute RISC catalytic subunit 4
Synonymsargonaute 4, Eif2c4, 5730550L01Rik
MMRRC Submission 044373-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.898) question?
Stock #R6256 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location126489541-126533472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126520226 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 91 (Y91H)
Ref Sequence ENSEMBL: ENSMUSP00000081312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084289]
Predicted Effect probably damaging
Transcript: ENSMUST00000084289
AA Change: Y91H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081312
Gene: ENSMUSG00000042500
AA Change: Y91H

DomainStartEndE-ValueType
Pfam:ArgoN 18 156 3.9e-28 PFAM
DUF1785 165 217 4.22e-24 SMART
PAZ 225 360 1.26e-3 SMART
Pfam:ArgoL2 365 412 1.2e-16 PFAM
Pfam:ArgoMid 421 503 8.6e-35 PFAM
Piwi 509 820 2.9e-130 SMART
Blast:Piwi 827 856 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122951
Meta Mutation Damage Score 0.9065 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which contain PAZ and PIWI domains and play an integral role in RNA interference and short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a cluster of related family members. [provided by RefSeq, Mar 2017]
PHENOTYPE: Male mice homozygous for a null mutation display oligozoospermia, decreased testis weight, premature entry into meiosis and disruption of sex body formation. However both males and females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Acad12 A T 5: 121,614,086 V54E probably benign Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Ago4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Ago4 APN 4 126517133 missense probably benign 0.01
IGL00965:Ago4 APN 4 126493314 missense probably benign 0.01
IGL01306:Ago4 APN 4 126515884 splice site probably null
IGL01943:Ago4 APN 4 126517195 missense probably damaging 1.00
IGL02079:Ago4 APN 4 126517084 missense probably damaging 0.99
IGL02117:Ago4 APN 4 126516852 missense probably benign 0.00
IGL02229:Ago4 APN 4 126511532 missense probably benign 0.34
IGL02503:Ago4 APN 4 126496805 nonsense probably null
IGL02504:Ago4 APN 4 126517439 missense probably benign 0.00
IGL02975:Ago4 APN 4 126512519 critical splice donor site probably null
BB010:Ago4 UTSW 4 126507018 missense probably benign 0.22
BB020:Ago4 UTSW 4 126507018 missense probably benign 0.22
IGL02837:Ago4 UTSW 4 126497300 missense possibly damaging 0.73
R0129:Ago4 UTSW 4 126517183 missense possibly damaging 0.85
R0142:Ago4 UTSW 4 126516932 missense probably benign 0.24
R0480:Ago4 UTSW 4 126526077 missense probably benign 0.00
R0533:Ago4 UTSW 4 126516860 missense probably benign 0.00
R1014:Ago4 UTSW 4 126506785 missense probably damaging 1.00
R1350:Ago4 UTSW 4 126507132 missense probably benign 0.04
R1547:Ago4 UTSW 4 126511413 missense probably benign 0.01
R1894:Ago4 UTSW 4 126512600 missense probably benign 0.11
R1900:Ago4 UTSW 4 126516936 missense probably benign 0.00
R2510:Ago4 UTSW 4 126517071 missense probably damaging 1.00
R2511:Ago4 UTSW 4 126517071 missense probably damaging 1.00
R4063:Ago4 UTSW 4 126515862 intron probably benign
R4064:Ago4 UTSW 4 126515862 intron probably benign
R4120:Ago4 UTSW 4 126496807 missense probably damaging 1.00
R4916:Ago4 UTSW 4 126506842 missense probably damaging 1.00
R4917:Ago4 UTSW 4 126506842 missense probably damaging 1.00
R4918:Ago4 UTSW 4 126506842 missense probably damaging 1.00
R4941:Ago4 UTSW 4 126526054 missense probably benign 0.00
R5169:Ago4 UTSW 4 126511727 missense probably benign 0.06
R5262:Ago4 UTSW 4 126496764 missense possibly damaging 0.66
R5385:Ago4 UTSW 4 126517556 missense probably benign
R5757:Ago4 UTSW 4 126526084 missense probably damaging 1.00
R6244:Ago4 UTSW 4 126511487 missense possibly damaging 0.67
R6389:Ago4 UTSW 4 126507244 missense probably damaging 1.00
R6545:Ago4 UTSW 4 126512018 missense probably benign 0.10
R7378:Ago4 UTSW 4 126511464 missense probably benign
R7804:Ago4 UTSW 4 126512630 missense probably benign 0.02
R7890:Ago4 UTSW 4 126526076 missense probably benign 0.00
R7933:Ago4 UTSW 4 126507018 missense probably benign 0.22
X0062:Ago4 UTSW 4 126515941 missense probably benign 0.00
X0064:Ago4 UTSW 4 126517482 missense possibly damaging 0.87
Z1176:Ago4 UTSW 4 126520190 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCAACAAGCTTGACTCCTC -3'
(R):5'- GTGGCACCACACAGAGTTAAGATG -3'

Sequencing Primer
(F):5'- ATCTCTGGAAGCCACACGG -3'
(R):5'- CCACACAGAGTTAAGATGAAAGC -3'
Posted On2018-02-28